ID: 1009953095

View in Genome Browser
Species Human (GRCh38)
Location 6:70419131-70419153
Sequence CCACCATGCCTGGCCAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3052
Summary {0: 6, 1: 28, 2: 174, 3: 703, 4: 2141}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009953095_1009953101 8 Left 1009953095 6:70419131-70419153 CCTGTTTTGGCCAGGCATGGTGG 0: 6
1: 28
2: 174
3: 703
4: 2141
Right 1009953101 6:70419162-70419184 TGTAATCCCAGCACTTTGGGAGG 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
1009953095_1009953106 30 Left 1009953095 6:70419131-70419153 CCTGTTTTGGCCAGGCATGGTGG 0: 6
1: 28
2: 174
3: 703
4: 2141
Right 1009953106 6:70419184-70419206 GCCGAGGCAGGCAGATCACGAGG 0: 2343
1: 13681
2: 40660
3: 57268
4: 59491
1009953095_1009953099 5 Left 1009953095 6:70419131-70419153 CCTGTTTTGGCCAGGCATGGTGG 0: 6
1: 28
2: 174
3: 703
4: 2141
Right 1009953099 6:70419159-70419181 GCCTGTAATCCCAGCACTTTGGG 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
1009953095_1009953098 4 Left 1009953095 6:70419131-70419153 CCTGTTTTGGCCAGGCATGGTGG 0: 6
1: 28
2: 174
3: 703
4: 2141
Right 1009953098 6:70419158-70419180 CGCCTGTAATCCCAGCACTTTGG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
1009953095_1009953105 18 Left 1009953095 6:70419131-70419153 CCTGTTTTGGCCAGGCATGGTGG 0: 6
1: 28
2: 174
3: 703
4: 2141
Right 1009953105 6:70419172-70419194 GCACTTTGGGAGGCCGAGGCAGG 0: 84291
1: 218536
2: 234154
3: 158283
4: 172560
1009953095_1009953103 14 Left 1009953095 6:70419131-70419153 CCTGTTTTGGCCAGGCATGGTGG 0: 6
1: 28
2: 174
3: 703
4: 2141
Right 1009953103 6:70419168-70419190 CCCAGCACTTTGGGAGGCCGAGG 0: 114360
1: 259489
2: 214307
3: 130302
4: 170463

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009953095 Original CRISPR CCACCATGCCTGGCCAAAAC AGG (reversed) Intronic
Too many off-targets to display for this crispr