ID: 1009957380

View in Genome Browser
Species Human (GRCh38)
Location 6:70471968-70471990
Sequence GGGAAGCCTTCATTTCTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 164}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009957380_1009957386 17 Left 1009957380 6:70471968-70471990 CCTTCAAGAAATGAAGGCTTCCC 0: 1
1: 0
2: 2
3: 13
4: 164
Right 1009957386 6:70472008-70472030 AAAATGAGCAGGATAGTGAGTGG 0: 1
1: 0
2: 1
3: 27
4: 341
1009957380_1009957385 6 Left 1009957380 6:70471968-70471990 CCTTCAAGAAATGAAGGCTTCCC 0: 1
1: 0
2: 2
3: 13
4: 164
Right 1009957385 6:70471997-70472019 TATAGAGTACAAAAATGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009957380 Original CRISPR GGGAAGCCTTCATTTCTTGA AGG (reversed) Intronic
901299187 1:8186636-8186658 GAGAAGTCTTCATGTCTTGTAGG + Intergenic
901328554 1:8385659-8385681 GGAGAGCTTTTATTTCTTGAAGG + Intronic
902674961 1:18002334-18002356 GGGAAGCATTCAGTCCTTGATGG - Intergenic
910508586 1:87978152-87978174 AGGAGCCCTTCATTTCATGAAGG + Intergenic
910944641 1:92577180-92577202 GGGAAGCCTTTGTTCCTTAAAGG - Intronic
911635130 1:100226693-100226715 TGGAATCATTCATTTCTTCAGGG - Intronic
916819100 1:168380836-168380858 AAGAAGCTTCCATTTCTTGAGGG + Intergenic
918213824 1:182375601-182375623 GGGAAAGCTCCATTTCTTGAAGG - Intergenic
918522832 1:185433302-185433324 GTGAAGATTTCATCTCTTGATGG + Intergenic
919496192 1:198271596-198271618 GGGAAACCTTTATTGCTTTAAGG - Intronic
920095148 1:203481917-203481939 CCGAAGCATTCATTTGTTGAGGG - Intronic
924300707 1:242634814-242634836 GGGAAGCTTCCCTTTCTTGATGG - Intergenic
1063243966 10:4199579-4199601 GAGAAGCCTGCATTTCAGGATGG - Intergenic
1065105250 10:22377204-22377226 GGGAAGCCTCCATTCCTTGCTGG - Intronic
1066382655 10:34914434-34914456 GAAAAGTCTTCATTTCCTGAAGG + Intergenic
1067471593 10:46541949-46541971 GTGAAGATTTCAATTCTTGAAGG - Intergenic
1067988759 10:51184277-51184299 AGGAAGCTTTTATTTTTTGATGG + Intronic
1069548281 10:69344402-69344424 GGGAAGCTTTGATTCCCTGATGG - Intronic
1070754111 10:78981209-78981231 GGGAACCCCTCATTCCTTGAAGG + Intergenic
1071500432 10:86199857-86199879 GCAAAGCCTTCATCTCTAGAAGG - Intronic
1072951571 10:99850988-99851010 GGGAACTATTCATATCTTGAGGG + Intronic
1073178192 10:101569215-101569237 GGGAAGCCAGCATTGATTGAGGG - Intergenic
1073589214 10:104740312-104740334 GAGAAGCCTTCATTTTATCAAGG - Intronic
1073636236 10:105201413-105201435 GGGAAGTCTGCATTCCTGGAAGG + Intronic
1076113826 10:127881528-127881550 AGGAAGCCTGCATTCCTGGAGGG - Intronic
1080179926 11:29413571-29413593 GTGAAGCCTTTATTTTTTCATGG + Intergenic
1080768027 11:35314843-35314865 GGCAAGCTTTTATTTCTTTAGGG + Intronic
1081645961 11:44791030-44791052 GGCTAGCCTTCATTTCTTGAGGG - Intronic
1086140861 11:83497940-83497962 GGGAAGCTTCCATTTGTTAATGG - Intronic
1086329696 11:85741560-85741582 GTGAAGATTTCATTTCTTGGAGG - Intronic
1086481936 11:87250047-87250069 GGAATGTATTCATTTCTTGAAGG + Intronic
1086844224 11:91728698-91728720 AGGAAGCTTCCATCTCTTGATGG + Intergenic
1086953421 11:92913317-92913339 GGGTGGGCTTCATTTCTTGCTGG + Intergenic
1090601087 11:128372189-128372211 GGGTAGCATTTTTTTCTTGAAGG + Intergenic
1091922173 12:4313893-4313915 GGGCAGCCTACTTTGCTTGAGGG + Intergenic
1092124143 12:6064059-6064081 AGGAAGCCTTCCTTTCTTGGAGG + Intronic
1093880066 12:24394144-24394166 GGGAAGCCTGCATTTCTCTTGGG + Intergenic
1094030439 12:26006140-26006162 GGGCAGCCTTGATTTCTTCCTGG + Intronic
1094624923 12:32114342-32114364 GGGAAGCGTACATTGCATGATGG + Intronic
1097677287 12:62616386-62616408 AGTAAGCCTTCATTTCTTTTTGG + Intergenic
1099028749 12:77498295-77498317 AGGATGACTTAATTTCTTGATGG + Intergenic
1099562973 12:84202371-84202393 GGGAAGGCTTCTTTGATTGAGGG + Intergenic
1099946699 12:89253215-89253237 GGGAGACCTTCATTTTCTGATGG + Intergenic
1100100804 12:91102219-91102241 GGGAAGACTTCATCTTTTCAGGG - Intergenic
1100200282 12:92290745-92290767 GGCAAGCCTCAATTTCTTGCTGG - Intergenic
1105819876 13:24070758-24070780 GGGAATTCTTCATTACTTGGGGG - Intronic
1108993655 13:56696683-56696705 GGGAAACCTTCATTTTTTGATGG + Intergenic
1110427713 13:75387975-75387997 GGGGAGAATTCATTTCTTTATGG + Intronic
1110947664 13:81443607-81443629 TGGCAGACTTCATTTCTTGTAGG + Intergenic
1112545237 13:100361891-100361913 GGTATGTCTTCATTTCTTGGGGG - Intronic
1112789796 13:102990582-102990604 GGGAAGCATTCAAAACTTGAGGG - Intergenic
1113500177 13:110767175-110767197 GGGATGTTCTCATTTCTTGAAGG + Intergenic
1113874614 13:113586189-113586211 GCGAATCCTGCATTTCTTGGGGG + Intronic
1114531539 14:23399709-23399731 GGGAAGCTCCCATTTCATGAAGG + Intronic
1114544976 14:23493153-23493175 AGGAAGGCTTCTATTCTTGAAGG + Intronic
1114673245 14:24424790-24424812 GGGCAGCCTTCCTTACTGGAGGG - Intergenic
1114959410 14:27866095-27866117 GGGAAGTCTTCAATTCTTTTAGG - Intergenic
1115000639 14:28416713-28416735 GGAATGCCTTCATTGTTTGAGGG - Intergenic
1115649780 14:35394674-35394696 TGGAAGCTTTCATTTCTTAGAGG - Intergenic
1116300351 14:43172612-43172634 GGTAAACCTTCATATATTGACGG - Intergenic
1116961032 14:50968665-50968687 GGAAAGACTTCATGTTTTGAGGG + Intergenic
1117256098 14:53979527-53979549 TGGAAGCATTCCTTTCGTGAGGG + Intergenic
1117549358 14:56818043-56818065 GGGAAGCGTGCATTTGTGGAAGG - Intergenic
1120942949 14:89966692-89966714 AGGAAGCCTGCCTTTCTTCAGGG - Intronic
1121106118 14:91281137-91281159 GGGGAGCGTTCATTTCAAGAAGG - Intronic
1121106623 14:91284005-91284027 GGGAAGCCTTAATCTCTGCATGG + Intronic
1126036420 15:44550039-44550061 GGGCATCCTTGCTTTCTTGATGG - Intronic
1126709580 15:51442216-51442238 AGTAAGTCTTCATTTCTTTAGGG + Intergenic
1127321295 15:57848896-57848918 TGGAAGCAATCATTTCTGGAAGG + Intergenic
1128601331 15:68997811-68997833 TGGTAGCTTTCATTTCTAGATGG - Intronic
1130179103 15:81607133-81607155 GGGAAAACTTCATTTCCTCAAGG - Intergenic
1131734254 15:95315156-95315178 GGGAAGCCCACATTCCTTAAGGG - Intergenic
1135623385 16:23975019-23975041 GGGAAGCCATCCTTTCTCCACGG - Intronic
1137596873 16:49729877-49729899 GGGAACCCATCACTTGTTGAGGG - Intronic
1139032179 16:62897993-62898015 GGGAAGATTTACTTTCTTGAAGG + Intergenic
1141199149 16:81883706-81883728 GGGAAGCCTTCCTTGACTGATGG + Intronic
1141745358 16:85922153-85922175 GGGCAGCCTTCATTTTGAGAAGG + Exonic
1148147377 17:45374276-45374298 GGCCAGACTTCAGTTCTTGACGG - Intergenic
1150367299 17:64600745-64600767 AGGAAATCTTCATTTATTGAGGG - Intronic
1150764975 17:67995536-67995558 GAGAACCCCTCATTTCTTCACGG + Intergenic
1156481937 18:37441776-37441798 GGGGAGCATTCTATTCTTGAAGG + Intronic
1156655286 18:39278010-39278032 TGGAACCATTCATTTCATGAAGG - Intergenic
1157199347 18:45645985-45646007 GGGTATCCTCCATTTCCTGAGGG - Intronic
1159890079 18:73944769-73944791 GAGAAGCTTTCTTGTCTTGAAGG + Intergenic
1163857390 19:19715237-19715259 GAAAAGCCTACAGTTCTTGAAGG - Intronic
1164870038 19:31635299-31635321 CGTAAGACTTCATTTCTAGAAGG + Intergenic
1166393371 19:42422737-42422759 GGGAAGGCCTCATTTCTCTAGGG - Intronic
1166929258 19:46291601-46291623 TGGAAGCCTTCATGTTTTTAGGG - Intergenic
926197366 2:10772052-10772074 GGGAAGCAGTCATTCCTTCATGG + Intronic
926856101 2:17257592-17257614 GGGCAGCCTTCGTGTCTTGAAGG + Intergenic
928644249 2:33335202-33335224 GGCCAGCCTTCTTTTCTAGAAGG + Intronic
929289025 2:40168238-40168260 AGGAAGCCTTCCTTTCCTGAAGG + Intronic
930998570 2:57753191-57753213 GAGAAGCTTTCATTTCCTTAAGG + Intergenic
932054471 2:68430743-68430765 GGGAGGGCTGCATTCCTTGATGG + Intergenic
932437665 2:71712211-71712233 GGGAAGCCTTAACTTCCTGGGGG + Intergenic
935973541 2:108555187-108555209 GGAAAGACTTTATTTTTTGAGGG + Intronic
940373999 2:152936447-152936469 GGGAATCCTTCTTTACTTGTTGG + Intergenic
940654287 2:156469614-156469636 GGGATGCCTTTATGTCTTGCTGG + Intronic
941084425 2:161100226-161100248 GGGAAGCATTTATTACGTGAAGG - Intergenic
944587748 2:201187364-201187386 AGTAAGCCTGAATTTCTTGATGG + Intronic
945063457 2:205928235-205928257 GGGAAACCTGCTCTTCTTGATGG + Intergenic
945329448 2:208522507-208522529 TGGATTCATTCATTTCTTGAAGG + Intronic
945684867 2:212957105-212957127 GGGAACCCTTCCTTTCCTTATGG + Intergenic
1169089396 20:2849045-2849067 GGGAAGCCTTCCTGTCTCCAAGG - Intronic
1169563499 20:6827443-6827465 GGCAGGCCTCCATTTCTTGCTGG - Intergenic
1169778505 20:9283020-9283042 CGAAAGTCTTCATATCTTGATGG + Intronic
1178177244 21:30117184-30117206 GGGAAGCCTCCATCTCCTAATGG - Intergenic
1179256741 21:39723230-39723252 GGCAAGCCTTTATTTCTTGCAGG + Intergenic
1181843145 22:25682438-25682460 GGGAAGCCTTGATTTCTCTGAGG + Intronic
950603952 3:14061179-14061201 AGGAAGCAGTAATTTCTTGATGG + Intronic
951623275 3:24630170-24630192 TGGAATCCTCCATTTCTTCAAGG + Intergenic
953906915 3:46872994-46873016 GAGAAGCCTCCATCTCTTGGGGG - Intronic
954151164 3:48657806-48657828 TGGAACCCTTCTTTTCTGGAGGG - Intronic
956616222 3:71175378-71175400 AGGGAGCCTCCATTCCTTGAAGG - Intronic
957315247 3:78568387-78568409 GAGAAGCCTAGATTTCTTGTTGG + Intergenic
957826997 3:85460497-85460519 GGGAAACCTTAAGTTTTTGAAGG + Intronic
959174664 3:102891535-102891557 AGGAAGCCATAATTTGTTGAGGG + Intergenic
962675457 3:137753882-137753904 TGGAATCATTGATTTCTTGAAGG - Intergenic
966068520 3:175845955-175845977 GGGAAGAATTCAGTTCTTCATGG + Intergenic
970133877 4:12900768-12900790 GGAAAGCATACATTTCTTCAAGG - Intergenic
970309912 4:14771386-14771408 GGAAAGACTGCATGTCTTGATGG + Intergenic
974707029 4:65532277-65532299 GAGAAGCTTTCATTACTTCATGG - Intronic
975185743 4:71400137-71400159 AGGAAGCCTTCTTTTATTAAGGG + Intronic
976428330 4:84932095-84932117 GGCAAGCCTTCTTTGCTTGTTGG - Intronic
976993800 4:91404350-91404372 TGGATTCCTTGATTTCTTGAAGG + Intronic
979808523 4:125005408-125005430 GAGAAGCCAACATGTCTTGATGG - Intergenic
979874411 4:125869713-125869735 GAGAAGCCTTCATTGATTCAAGG - Intergenic
980126260 4:128777348-128777370 GAGTAGCCTTCATTTATTAAGGG - Intergenic
980190240 4:129516073-129516095 GGAAAGCTTTCATTTCATGAAGG + Intergenic
980202253 4:129670787-129670809 GGGAGGCCTTCATTTCTGAAGGG + Intergenic
981428118 4:144627236-144627258 TGAAAGCCTCCATTTCTTGTTGG - Intergenic
981487335 4:145301256-145301278 GAGAAGCCCTCATTTCTAAAGGG - Intergenic
986282567 5:6335549-6335571 GTGAAGCCTTTCTGTCTTGAAGG + Intergenic
987843619 5:23253736-23253758 ATGAGGCCTTCATTGCTTGAGGG + Intergenic
988716950 5:33837517-33837539 GAAAATCCTTCATTTCTTGCAGG + Intronic
991223866 5:64246300-64246322 TGGATTCCTTGATTTCTTGAAGG - Intronic
994080690 5:95706141-95706163 AGGAAGACTTCATAGCTTGATGG - Intergenic
994081573 5:95713214-95713236 AGGAAGACTTCATAGCTTGATGG - Intergenic
996620965 5:125502179-125502201 GGGAGGCCACCATTCCTTGAAGG - Intergenic
1000971967 5:167724673-167724695 GAGAAGACTTCATTTCTTTGTGG + Intronic
1001013255 5:168117664-168117686 GGGACTACTTCATTTCTTCATGG + Intronic
1001293153 5:170479543-170479565 GAGAAGTCTTCATGTCTTAAAGG - Intronic
1007165416 6:39825449-39825471 GGGGGGCCTTTGTTTCTTGAAGG + Intronic
1009749276 6:67862311-67862333 GGAAAACTTTCCTTTCTTGATGG + Intergenic
1009957380 6:70471968-70471990 GGGAAGCCTTCATTTCTTGAAGG - Intronic
1010184334 6:73125488-73125510 TGGATGCCTTCATTTCTTTATGG - Intronic
1012872365 6:104687270-104687292 GGGGAGTCTGCATTTCCTGAGGG + Intergenic
1013194479 6:107833181-107833203 GTCAAGCCTTCCTTTCTAGAAGG - Intergenic
1014370726 6:120604140-120604162 AGGAAACCTTCATTTATTGGTGG - Intergenic
1017403813 6:154094923-154094945 GGGAAGCCATTACTTCCTGAGGG + Intronic
1017685281 6:156907155-156907177 TGGAAGCCTTCATTTAATCAGGG - Intronic
1018319913 6:162596981-162597003 AGGAGCCCTGCATTTCTTGAAGG - Intronic
1018835771 6:167482547-167482569 GGGTTGCCTTCATTTCTAGTTGG + Intergenic
1022957512 7:35394953-35394975 GGTATGTCTTCATTTATTGAGGG - Intergenic
1023539122 7:41246221-41246243 AGGCAGACTGCATTTCTTGAAGG + Intergenic
1023593870 7:41808659-41808681 GGGAAGGATTCCTTTCTGGATGG - Intergenic
1026255075 7:68704056-68704078 GGGAAGCCTTTTTTTTTTTAAGG - Intergenic
1028260315 7:88656263-88656285 GGGATTCCTTCATTTAATGAAGG + Intergenic
1030758485 7:113320319-113320341 GGGAAGCCTTTATTTAATTAAGG + Intergenic
1032155844 7:129467037-129467059 GGGGAGCCTTCCTTTCCTGTTGG + Intronic
1032491858 7:132329775-132329797 TGGGAGCCTTCATTTCTTTTTGG - Intronic
1033120513 7:138663769-138663791 GTGAAGCCTGAACTTCTTGAAGG - Intronic
1039733820 8:40308294-40308316 GGGAGGCCTTTATCTCCTGATGG + Intergenic
1045799431 8:106085042-106085064 GGGGACCCTTAATTTCTAGAAGG - Intergenic
1045871738 8:106934980-106935002 TGGAAGCCTTCATCTCCAGAAGG + Intergenic
1046073814 8:109291939-109291961 TGGAAGCCTTAATTTTTTTAAGG - Intronic
1047590936 8:126326524-126326546 ATTAAGCCTTCATTTCTAGAGGG - Intergenic
1048784148 8:138032764-138032786 GAGAAGTCTTCATTTTTTAAGGG - Intergenic
1049150438 8:141031790-141031812 GAGAAGCCAGCATTTGTTGATGG - Intergenic
1053406106 9:37877448-37877470 GGTCAGCCTTCATTTGTTAATGG - Intronic
1058543363 9:106035317-106035339 GGGCAGAATTCATTTCTTGGTGG + Intergenic
1058804748 9:108579902-108579924 TGGAGGCCTTCATTACTGGAGGG - Intergenic
1059639777 9:116205156-116205178 GGGAAGCCTCCATTTCCCTAAGG - Intronic
1061900981 9:133671829-133671851 TGGAAGACCCCATTTCTTGATGG - Intronic
1186676966 X:11828364-11828386 AGGAAACCTTTATTTGTTGAAGG + Intergenic
1187737666 X:22321385-22321407 GGGAAGTCATCATATTTTGATGG - Intergenic
1188739644 X:33762786-33762808 GCGAAGCCTTCATATCATAAAGG - Intergenic
1192797232 X:74434154-74434176 GGGAATCATACACTTCTTGAGGG - Intronic
1193452736 X:81690603-81690625 GGGAATCCTTAATTTTTTGAAGG - Intergenic
1201329977 Y:12807819-12807841 TGGAAGTCTTCATTTCTCCAAGG + Intronic