ID: 1009958453

View in Genome Browser
Species Human (GRCh38)
Location 6:70486955-70486977
Sequence CTGCAGAAATAGAGAAGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 706
Summary {0: 1, 1: 0, 2: 1, 3: 70, 4: 634}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009958451_1009958453 8 Left 1009958451 6:70486924-70486946 CCTCAAAAAAAACTAAACCTAGT 0: 1
1: 0
2: 1
3: 63
4: 632
Right 1009958453 6:70486955-70486977 CTGCAGAAATAGAGAAGAGATGG 0: 1
1: 0
2: 1
3: 70
4: 634
1009958452_1009958453 -9 Left 1009958452 6:70486941-70486963 CCTAGTTTTCTGCACTGCAGAAA 0: 1
1: 0
2: 2
3: 29
4: 316
Right 1009958453 6:70486955-70486977 CTGCAGAAATAGAGAAGAGATGG 0: 1
1: 0
2: 1
3: 70
4: 634

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009958453 Original CRISPR CTGCAGAAATAGAGAAGAGA TGG Intronic
900638218 1:3675960-3675982 CTGGAGAGATAGGGATGAGATGG + Intronic
901248220 1:7750526-7750548 CTGCAGAGCTACAGAAGTGAGGG - Intronic
901328672 1:8386891-8386913 CTTCACAAATAGAAAAAAGACGG + Intronic
902235533 1:15055000-15055022 CTGCAGAACTAGCAAGGAGATGG - Intronic
902954764 1:19917980-19918002 CTGCAGAAACAGAAAACACAGGG - Intergenic
903299076 1:22365261-22365283 ATTCAGAAATAGAGTTGAGATGG - Intergenic
903852037 1:26313328-26313350 CTGCAGAACAAGAGAAGACCAGG - Intronic
905514547 1:38552564-38552586 TAGGAGAAATGGAGAAGAGACGG - Intergenic
905530481 1:38674788-38674810 CTGCAGAAATAGAGGGGCGGGGG + Intergenic
905991817 1:42344196-42344218 CTGCAGAAAAAGAGATCTGATGG - Intergenic
906245188 1:44268419-44268441 CTGGGGCACTAGAGAAGAGATGG - Intronic
906579019 1:46919251-46919273 CTACACTAATAGAGAAGAAAAGG - Intergenic
906782706 1:48586709-48586731 CTGCATCATGAGAGAAGAGAGGG + Intronic
907651229 1:56296646-56296668 CTGCAGACTTAGAGTAGACAAGG + Intergenic
908175743 1:61553462-61553484 ATAAAGAAATAGAGATGAGAAGG - Intergenic
908634092 1:66143166-66143188 CTGCAGTAAAAGTGAAGACAAGG + Intronic
908693734 1:66812716-66812738 CTGCAGAAGCAGGGATGAGAAGG + Intergenic
909047947 1:70732625-70732647 CTGCAGAAAAAAAAGAGAGAAGG - Intergenic
909193847 1:72590954-72590976 CTGCACAATTACAGAAGAAAAGG + Intergenic
909691744 1:78415376-78415398 CTGCAGATTTAGGCAAGAGAAGG + Intronic
909697929 1:78488285-78488307 CTGCTCAAATAAATAAGAGAGGG + Intronic
909865739 1:80667953-80667975 CTGGAGGAATAGAGATAAGATGG + Intergenic
911140174 1:94492729-94492751 CTGCATAAAGACAGAAGTGAGGG - Intronic
913253926 1:116937421-116937443 CTGCAGTAATGCAGATGAGACGG + Intronic
914349660 1:146830022-146830044 CAGCAGAAAGCTAGAAGAGATGG - Intergenic
915645597 1:157269810-157269832 CCCCAGATTTAGAGAAGAGACGG - Intergenic
916152633 1:161810320-161810342 CAGGAGAAAGAGAGAAAAGAGGG + Intronic
916318295 1:163474792-163474814 CTGAAGAAAAAAAGAAGACAAGG - Intergenic
916443641 1:164852189-164852211 CAGCAGACAAAGAGAAGAAAAGG - Intronic
916786799 1:168092440-168092462 CTGCATAAACACAGAGGAGAGGG - Intronic
916869986 1:168903287-168903309 CTAGAGAAATAGAGAATAGTTGG - Intergenic
917292030 1:173479965-173479987 CTCCAGAAGTTGAGAAGAAATGG - Intronic
917542431 1:175927233-175927255 CTGAAGCAAGAGAGAGGAGAAGG + Intergenic
917590171 1:176468471-176468493 TAGGAGGAATAGAGAAGAGATGG - Intronic
917882613 1:179352970-179352992 GTTCAGAAATAGGAAAGAGAGGG - Intronic
918057249 1:181032710-181032732 CTCTAGAACTAGAAAAGAGAAGG - Intergenic
918454856 1:184699405-184699427 TTCCAGAAAAAGGGAAGAGATGG + Intronic
918651890 1:186975622-186975644 CAGATGAAATAGAGATGAGATGG + Intronic
918722818 1:187875598-187875620 CAGGAGAAATAGAGGGGAGAGGG + Intergenic
918981413 1:191564763-191564785 CTGGAGAAATGCAGAAGAAAGGG + Intergenic
919153156 1:193725578-193725600 CTGCAGGATGAGAGAAGAGAAGG - Intergenic
919166071 1:193894984-193895006 ATGCAAAAACAGAGAGGAGAAGG - Intergenic
919275267 1:195406735-195406757 CTGAAGAAACAGAGAAGATGAGG - Intergenic
919601237 1:199625024-199625046 ATGAAGAAAAGGAGAAGAGAAGG + Intergenic
920045769 1:203131377-203131399 TTGCAGAAATAGATAAGATGTGG - Intronic
920729820 1:208472989-208473011 CTGCAGATGTGGAGAAGTGAAGG - Intergenic
920812434 1:209299440-209299462 CTGAAGATACAAAGAAGAGAAGG - Intergenic
920858221 1:209681420-209681442 GTGCAGAAAAAGAGAAGAGCAGG + Intergenic
921724698 1:218510963-218510985 CAGCTAAAATAGAGCAGAGACGG + Intergenic
921838614 1:219804461-219804483 CTGGATAAATAGAGAACATAAGG - Intronic
921839945 1:219817705-219817727 CTGCAGAAGGAGACAAGAAAAGG + Intronic
921894753 1:220388402-220388424 CTTCAGATGAAGAGAAGAGAGGG - Intergenic
922464375 1:225836743-225836765 CAGCAGAAGCAGAGAGGAGAAGG + Intronic
922917808 1:229272423-229272445 CTGCAGAAACACAGCAGACACGG + Intronic
923187853 1:231591311-231591333 ATGCAGAAATAAATAAGTGAGGG - Intronic
923260594 1:232264368-232264390 CTGCAGAGATGGAGAAAAAATGG - Intergenic
923291271 1:232548656-232548678 CTGCAGGAGTAGTGAAAAGAGGG + Intronic
923579895 1:235199548-235199570 GTGGAGAATTAGAGAAGAGAAGG + Intronic
923685881 1:236153310-236153332 CTGCAGAGATAGAAAGCAGATGG - Intronic
923995785 1:239492686-239492708 CTGCAGACAGAGAAAAAAGACGG - Intronic
924603574 1:245513059-245513081 CTCCAGAAATAGAAAAGAAAAGG + Intronic
1062892517 10:1074745-1074767 GAGCAGCAATATAGAAGAGAGGG + Intronic
1063044109 10:2373936-2373958 CTGCAGAAAGAAAGAAGGAAGGG - Intergenic
1063763303 10:9106951-9106973 ATTGAGAAATAGACAAGAGAAGG + Intergenic
1063781981 10:9335521-9335543 CTGAAGTAATAGAGTAGATAAGG + Intergenic
1064767098 10:18686188-18686210 CTGGAGGAAAAGTGAAGAGATGG + Intergenic
1064968624 10:21040490-21040512 AAGGAGAAATAGAGGAGAGAAGG + Intronic
1065451425 10:25862581-25862603 CTGCAGAATGAGAGAAAAAATGG + Intergenic
1065607919 10:27440002-27440024 CCTCAGAAATAGAGAAGTCATGG - Intergenic
1065833657 10:29637917-29637939 TTATAGAAATGGAGAAGAGATGG + Intronic
1065903320 10:30227242-30227264 CTGCCTAAAGAGAGACGAGAAGG + Intergenic
1065968303 10:30786015-30786037 CAGCAGGAATATAGAAGAAAAGG - Intergenic
1066260437 10:33724574-33724596 CTCCAGAAACAGAAAAGGGATGG - Intergenic
1067237896 10:44467154-44467176 CTGCAGAAAGAGAGAGGACTGGG + Intergenic
1067739686 10:48885494-48885516 CTGCAGACATGGAGAAGACCAGG - Intronic
1068451067 10:57189293-57189315 CCACAGAGATAGAGAATAGAAGG - Intergenic
1068708748 10:60108303-60108325 CAGCAGAAAGAGAAACGAGAAGG + Intronic
1069190270 10:65478745-65478767 CTGGAGAAACAGACAAGAAAAGG + Intergenic
1069196118 10:65553484-65553506 CAAAAGAAATAGAGAAGAAAGGG + Intergenic
1069869373 10:71523887-71523909 GTGCAGGAATACAGAAGAGCAGG - Intronic
1070552113 10:77498108-77498130 ATGCAGAAAAAGAGAAGGCAGGG + Intronic
1071055992 10:81508344-81508366 CTTCAGAAAAAGGGAAGTGAAGG + Intergenic
1071129055 10:82370385-82370407 CGGCAGAGAAAGAGAAGAGGAGG - Intronic
1071388947 10:85150593-85150615 CTACAGAAATACACAAGAGGAGG - Intergenic
1071565329 10:86668646-86668668 CTGCAGACAAAGGGTAGAGAGGG - Intronic
1071599188 10:86948623-86948645 TTTCAGAAAGAGAGAACAGATGG + Intronic
1071771143 10:88729915-88729937 GTGGAAAAAGAGAGAAGAGAGGG - Intronic
1072184866 10:93027466-93027488 TTTCATAACTAGAGAAGAGAAGG + Intronic
1072625391 10:97107947-97107969 CTGCACAAAGAGAGATGAAAGGG + Intronic
1072711622 10:97719197-97719219 CTGCTAAAATAGAGTAGAGCAGG - Intergenic
1073120721 10:101121278-101121300 CTGCAGAAATAGACGATAAATGG + Intronic
1074120667 10:110492056-110492078 CTGAAGTTTTAGAGAAGAGAAGG - Intergenic
1074164777 10:110865499-110865521 CTGCAGACATAGAGGGGAGGGGG + Intergenic
1074591491 10:114817952-114817974 CTGTAGAAATAGGAAGGAGATGG - Intergenic
1076254380 10:129009975-129009997 CTGCAGAACTAGGGACAAGAGGG + Intergenic
1076324240 10:129609028-129609050 CAGCAGTAAGAGAGGAGAGAAGG - Intronic
1077914424 11:6602039-6602061 CTGCTGAAGTAGGGAAGAAAGGG - Exonic
1079378410 11:19914989-19915011 CTGTATAAAAAGAGGAGAGAAGG - Intronic
1079824822 11:25177780-25177802 CTGCAGAGAAAAAGTAGAGAAGG + Intergenic
1080192165 11:29563938-29563960 CTGCATAAATACAGAAAAAAAGG - Intergenic
1080238556 11:30099945-30099967 CTGGAGAAAGGAAGAAGAGATGG - Intergenic
1081811232 11:45915216-45915238 CTGCAGGAAGAGGGAACAGATGG - Intronic
1082177931 11:49083061-49083083 CTGCAGCAGTGGAGAAGAAATGG + Intergenic
1082751437 11:57022620-57022642 TGGCAGATAAAGAGAAGAGAAGG - Intergenic
1082771716 11:57213138-57213160 ATGCAGAAATAAATAAGACAAGG + Intergenic
1083505964 11:63157426-63157448 CTGAAGAAAGATAAAAGAGAGGG - Intronic
1084010085 11:66342988-66343010 CTGAAGACACAGAAAAGAGAGGG - Intronic
1084040503 11:66539825-66539847 CTGCAATAAAAGAGCAGAGAGGG + Intronic
1087100730 11:94361650-94361672 CTGGATAAATAGCGAAAAGAAGG + Intergenic
1087138330 11:94741626-94741648 CTGAAGAGAGAGTGAAGAGAAGG + Intronic
1087396355 11:97604777-97604799 CTGCAGTAATGGAGCAGGGAAGG + Intergenic
1088121522 11:106375900-106375922 CTGGACAAACAGGGAAGAGATGG + Intergenic
1089302136 11:117505044-117505066 CTGCAGAAAGAGGGAAGGTAGGG + Intronic
1089326671 11:117662131-117662153 ATCCAGAAAAAGGGAAGAGAGGG + Intronic
1089372332 11:117970266-117970288 CTGCAGAAGGGGGGAAGAGAAGG + Intergenic
1089723830 11:120455177-120455199 CTGAGGACATGGAGAAGAGATGG + Intronic
1089991576 11:122866124-122866146 CTGCAGAAGTAGGTAATAGATGG - Intronic
1090227342 11:125079661-125079683 CTGCAGGGAGAGAGAAGGGAGGG - Intronic
1090311557 11:125745844-125745866 CTCTAGGAATGGAGAAGAGAGGG - Intergenic
1091038605 11:132256027-132256049 GTGCAGGGATAGAGAAGAGAAGG - Intronic
1091258595 11:134214825-134214847 CTTCCAAAATACAGAAGAGAAGG + Intronic
1091517937 12:1204379-1204401 ATGCAGGATTAGAGAAGGGAAGG - Intronic
1091694888 12:2621790-2621812 TTGCTGAAATAGAGAAGAACAGG + Intronic
1091819113 12:3461309-3461331 TTGGAGGAATGGAGAAGAGATGG + Intronic
1092021945 12:5210142-5210164 CAGTAAAAATAGAGAAAAGATGG - Intergenic
1092804664 12:12208966-12208988 ATGCATTAATAGAGAAAAGATGG - Intronic
1094052971 12:26240616-26240638 CTGCAGAAAGAAAGAAGCAAAGG - Intronic
1095901441 12:47332716-47332738 TTGCAGAAATAGAAGAGAAAAGG - Intergenic
1096764424 12:53871987-53872009 CTGAAGAGCTAGAGGAGAGAGGG + Intergenic
1097180631 12:57169770-57169792 CTGAAGAGACAGAGGAGAGAGGG + Intronic
1097533470 12:60835811-60835833 CTACAGTAAAAGAGAAAAGAAGG - Intergenic
1097984622 12:65770357-65770379 GTGCATAACTAGAAAAGAGAAGG - Intergenic
1098936730 12:76488735-76488757 CTGATGGAATAGAGAAGAGCCGG - Intronic
1099913365 12:88861117-88861139 TTTGAGAAAGAGAGAAGAGAGGG - Intergenic
1100186613 12:92146005-92146027 GTCCAGAGATAGGGAAGAGAGGG + Intergenic
1100292587 12:93232057-93232079 CTGCAGCAAAAGGGAATAGATGG - Intergenic
1100419564 12:94418416-94418438 CAGCAGAAATAGAGAGGAAGAGG + Intronic
1100762802 12:97828192-97828214 GTAGAGAAATAGAGAAGATAAGG + Intergenic
1100856125 12:98758722-98758744 CTGGGGAAGAAGAGAAGAGAAGG - Intronic
1101549588 12:105749545-105749567 TTGCAGAACTAGAAATGAGAGGG + Intergenic
1101837328 12:108304627-108304649 CTGCAGAGAGATGGAAGAGACGG - Intronic
1102720498 12:115012152-115012174 CTGAAGAAGGAGAGAAGAAAAGG - Intergenic
1103974824 12:124695582-124695604 ATGAAAAAAGAGAGAAGAGAAGG - Intergenic
1104938870 12:132385132-132385154 CTTCAGGAATAGAGAAGTGGCGG + Intergenic
1105226619 13:18440800-18440822 CTGGAGATATAAAGAAGAGCTGG - Intergenic
1105631582 13:22174879-22174901 TTGCTGAAAGAGAGAAGAGAAGG - Intergenic
1105760805 13:23512616-23512638 CTGCAGATGCAGAGAAGAGAAGG - Intergenic
1106738313 13:32611314-32611336 CAACAGGCATAGAGAAGAGAAGG - Intronic
1106866778 13:33973427-33973449 CTGCAAAAGTAGAGAAGACTGGG - Intergenic
1107030983 13:35853531-35853553 GTGCAGAAATCTTGAAGAGAGGG + Intronic
1107182465 13:37477286-37477308 CTGGATATAGAGAGAAGAGATGG + Intergenic
1107367138 13:39693320-39693342 CTTAAGAAAGAGAGAAAAGAGGG - Intronic
1108080694 13:46731852-46731874 ATGCTGAAATAGAGAAGGAAAGG - Intronic
1108121420 13:47191188-47191210 CTGCATTAATTGAGAACAGAAGG + Intergenic
1108340405 13:49493988-49494010 TTCCAGAAACAGTGAAGAGATGG - Exonic
1108527307 13:51296857-51296879 CAGCAGAAAGAGAGAGGAGAGGG + Intergenic
1109857704 13:68155480-68155502 CAGAAGAAAGAGAGAAGAGGCGG + Intergenic
1110369145 13:74720235-74720257 CAGCAGAAAAAGAGAACAGTTGG - Intergenic
1110522563 13:76498106-76498128 GTGCAGAAATAGAGGAAGGAAGG + Intergenic
1111058470 13:82980940-82980962 ATCTAGAAATAGAGAAGATATGG - Intergenic
1111333345 13:86790414-86790436 GTGAAGATACAGAGAAGAGATGG - Intergenic
1111744762 13:92253771-92253793 CTGTAGAAATAAAAAAAAGAAGG + Intronic
1112161592 13:96874052-96874074 CTGCAGAAACAAAAAGGAGAGGG + Intergenic
1112191038 13:97177595-97177617 ATGAAGAAATAGAGAAAAGTTGG + Intergenic
1112269743 13:97957786-97957808 CTTCAGAGATAAAAAAGAGAAGG - Intronic
1112349461 13:98620853-98620875 TTACAAAAATAGAGAAAAGATGG + Intergenic
1112471903 13:99696952-99696974 CTGTTGAAACAGAGAAGACAGGG - Intronic
1112735061 13:102407102-102407124 TTGCAGACAGAGAGAAAAGAAGG - Intergenic
1112854565 13:103751345-103751367 GGGCAGAAATAGGTAAGAGAAGG + Intergenic
1113342499 13:109440745-109440767 CTTCAGAAAGAGGGAAGATATGG + Intergenic
1113537271 13:111077756-111077778 TTCCGGAAAAAGAGAAGAGAGGG + Intergenic
1114404740 14:22445854-22445876 CTGCAGGAATGGGGAAGAGCAGG + Intergenic
1115082565 14:29474627-29474649 GTCCAGAAAGAAAGAAGAGAAGG + Intergenic
1115571440 14:34670511-34670533 CAGCAGAGATCAAGAAGAGAGGG + Intergenic
1115650535 14:35399651-35399673 CTACAGAAATGGAGCAGAGCTGG + Intergenic
1115803601 14:37024843-37024865 CTTCAGAAATGGAGAAAAAAAGG + Intronic
1116500932 14:45620369-45620391 CTGCTGAAAGAAAGCAGAGATGG - Intergenic
1117081540 14:52157114-52157136 CTGCAGAGATGGTGATGAGATGG - Intergenic
1117091402 14:52254464-52254486 CTTCATAAAAAGAGGAGAGATGG - Intergenic
1117202252 14:53403279-53403301 CTGGAGAAATGGAGGTGAGATGG - Intergenic
1117903511 14:60560502-60560524 ATGCAGTAATAGAGATGAGAAGG - Intergenic
1118106567 14:62666521-62666543 CTGCAGTCATAGAGAGCAGAAGG + Intergenic
1118503820 14:66389240-66389262 GTGCAGCAAGAGAGAAAAGAGGG + Intergenic
1119195193 14:72712503-72712525 CTGCAGAGATAGAGCAAAAAGGG + Intronic
1119214087 14:72855357-72855379 CTCCAGGAATACAGATGAGATGG - Intronic
1119498215 14:75099474-75099496 CAGCAGCAGTACAGAAGAGAAGG + Intronic
1119929329 14:78529641-78529663 CTACAGAAATAGATAACTGAGGG - Intronic
1121590314 14:95101303-95101325 CTGCAGAAATAAGGAGTAGAAGG + Intronic
1121822039 14:96978292-96978314 CTGGAAAAAAAGAGAAAAGAAGG - Intergenic
1122055505 14:99095499-99095521 CTACTGAAATAGAACAGAGATGG + Intergenic
1122256783 14:100483968-100483990 CAACACAAAAAGAGAAGAGAGGG - Intronic
1123043065 14:105498411-105498433 CTTCAGAAAAAGAAAATAGATGG - Intronic
1123178652 14:106446137-106446159 CTGAAGAAAGAGAGAGGAGGTGG - Intergenic
1124080001 15:26484678-26484700 CTACAGAAACAGAAAAGAGATGG + Intergenic
1125285690 15:38090230-38090252 CCTCAGAAACAGAGAAGGGAGGG - Intergenic
1126345797 15:47692751-47692773 CTACACAACTAGAAAAGAGAAGG - Intronic
1127027297 15:54821013-54821035 CTGAAGAACTAGGGAAGAGCTGG - Intergenic
1127417805 15:58774047-58774069 CTGCAGAAATTCAGAGGAAAGGG + Intronic
1127664368 15:61130866-61130888 AAGAAGAAATAAAGAAGAGAAGG + Intronic
1127828250 15:62725328-62725350 CTTCAGACATAGAGGAGATATGG - Intronic
1128659258 15:69485985-69486007 CTGCAGATAGAGACAAGAGGAGG - Intergenic
1128812147 15:70580528-70580550 CTTCAAAAAGAGAGAAGGGAGGG - Intergenic
1129528697 15:76242934-76242956 TTTCAGAAATAGAGTAGTGATGG + Intronic
1129955835 15:79636015-79636037 CAGCAGCAATAAAGAGGAGATGG + Intergenic
1130027725 15:80284271-80284293 TCCCAGAAATAGAGAACAGAAGG - Intergenic
1130144819 15:81265906-81265928 CCGCAGAACTACAGAGGAGAGGG + Intronic
1130874539 15:88001717-88001739 CTACAGTAATAGAGACGATATGG - Intronic
1132484776 16:185140-185162 CTGCAGGAGAACAGAAGAGAAGG - Intergenic
1133463348 16:6006509-6006531 CAGAAGAAAGAAAGAAGAGATGG + Intergenic
1134857273 16:17530713-17530735 GAGAAGACATAGAGAAGAGAAGG - Intergenic
1137554677 16:49463118-49463140 CTGGAGAGACAGAGAAGAGAAGG - Intergenic
1137755558 16:50899353-50899375 GTGAAGAAATATAGAAGGGAAGG - Intergenic
1138524612 16:57595482-57595504 ATGCAGAAATATACAAGATAGGG - Intergenic
1139205956 16:65028551-65028573 CTGCAGAGTAAGGGAAGAGAGGG - Intronic
1139620035 16:68131893-68131915 CTCCAGCAATTGAGAAGAGTTGG - Intronic
1139984375 16:70885524-70885546 CAGCAGAAAGCTAGAAGAGATGG + Intronic
1140091225 16:71840720-71840742 CTGAGGAAATATACAAGAGATGG + Intergenic
1140712560 16:77691986-77692008 CTGCAGGTGAAGAGAAGAGATGG - Intergenic
1141517596 16:84556424-84556446 CTGCAAAAAGAGAGGAGGGAGGG + Intergenic
1141847585 16:86621529-86621551 AAGAAGAAATAAAGAAGAGATGG - Intergenic
1142493677 17:294627-294649 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493716 17:294875-294897 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493771 17:295233-295255 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493815 17:295507-295529 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493833 17:295616-295638 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493848 17:295725-295747 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493866 17:295834-295856 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493881 17:295943-295965 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142902753 17:3023284-3023306 CTGCTGAAATAAAGAACAAATGG - Intronic
1143054249 17:4150921-4150943 CTGCAGATAGATAGAAGAAAGGG - Intronic
1143106318 17:4532228-4532250 GTGGATAGATAGAGAAGAGATGG - Intronic
1143271570 17:5679318-5679340 GTGAAGACATAGAGAAAAGATGG + Intergenic
1143344621 17:6240756-6240778 CTGCAGAGAGAAAGCAGAGAGGG - Intergenic
1144234401 17:13243556-13243578 TTGCAGAAAGAGTGAAAAGATGG - Intergenic
1144297321 17:13888473-13888495 CTCCAGAAATAAAGAAGCGGGGG - Intergenic
1144349466 17:14380894-14380916 GTGCAGAAACAGAAGAGAGAAGG + Intergenic
1146635667 17:34502580-34502602 CTGCAAACAAAGTGAAGAGAAGG + Intergenic
1146662108 17:34671711-34671733 ATGCAGTCATAGAAAAGAGAAGG + Intergenic
1146922236 17:36721435-36721457 TTACAGAAATAGAAAGGAGAGGG - Intergenic
1147036767 17:37687393-37687415 CTGCAGAGAGAGAGGAGAGAGGG + Intronic
1147236646 17:39062641-39062663 TTGCAGCAATAGAGAAAGGAAGG - Intergenic
1147638052 17:41975904-41975926 ATGCAGAAAGGGAGCAGAGAAGG + Exonic
1148147356 17:45374129-45374151 CTGCAGGGAAAGAGAGGAGAGGG - Intergenic
1148236440 17:45972243-45972265 CTGAAGAAAGAGAGAGGAGGGGG - Intronic
1148384728 17:47226029-47226051 CTGAAGAAAGAAAGAAGAGAGGG - Intergenic
1149026231 17:52030507-52030529 CTGCATATTTAGAGCAGAGATGG - Intronic
1149126786 17:53244266-53244288 CTGCCAAAATAAAGAAGAAATGG + Intergenic
1149273041 17:55003563-55003585 CTGAAGAAATCTAGAAGTGATGG - Intronic
1149411150 17:56408581-56408603 TTGCAGAAAAAGAGATGAGATGG + Intronic
1149798528 17:59544372-59544394 ATAAATAAATAGAGAAGAGAAGG + Intergenic
1150125436 17:62631884-62631906 CTGCAGAACTGAAGTAGAGATGG + Intronic
1150952611 17:69820811-69820833 CTGCAGAGTTTGTGAAGAGAAGG + Intergenic
1153106383 18:1533050-1533072 ATGCAGAATTAGAAAAGATAAGG - Intergenic
1153615773 18:6931617-6931639 ATTCAGAAAGAGAGAAGAGATGG - Intergenic
1153992509 18:10412939-10412961 TTGGTGAGATAGAGAAGAGATGG - Intergenic
1154526759 18:15298675-15298697 CTGGAGATATAAAGAAGAGCTGG + Intergenic
1154943656 18:21138465-21138487 CTGAAGAAAGAAAGAAGAGGGGG + Intergenic
1154960938 18:21307892-21307914 CTGGAGGAAAAGAGATGAGAAGG - Intronic
1155049709 18:22135925-22135947 CAGCAGAGATAGAGATGGGATGG + Intergenic
1156045396 18:32871844-32871866 CGTCAGAAAAAGAGAAGAAAGGG - Intergenic
1156111236 18:33729917-33729939 CTGCTGCAATAGGGAAGGGATGG - Intronic
1156532860 18:37835016-37835038 CCCCAAAATTAGAGAAGAGATGG - Intergenic
1156549782 18:38003693-38003715 CAGCAGAGAAAGAGAAGAGGAGG + Intergenic
1156715558 18:40005041-40005063 CTGCAGAAGAACAGAATAGAGGG + Intergenic
1156891532 18:42195790-42195812 CTGTAGAATTCTAGAAGAGAAGG - Intergenic
1156930484 18:42636391-42636413 ATTAAGAAATAGTGAAGAGATGG + Intergenic
1157034589 18:43955678-43955700 GTTTTGAAATAGAGAAGAGAAGG - Intergenic
1157083811 18:44556346-44556368 CTGCAGAAATAAGGAGGAGTAGG + Intergenic
1157598050 18:48875684-48875706 CTGCAGAGATGGAGACTAGATGG - Intergenic
1157993589 18:52527638-52527660 CTGCAGACTGAGAGATGAGATGG - Intronic
1158340466 18:56460487-56460509 TGGCAGAATTAGAGGAGAGATGG + Intergenic
1159266219 18:66083316-66083338 CTGCAGCAACAGTGAAGAGAAGG + Intergenic
1159764999 18:72478832-72478854 CTGCATAAGTAGAGAAGTGTTGG - Intergenic
1160141426 18:76327206-76327228 GTGCAGAATTTCAGAAGAGATGG + Intergenic
1160237867 18:77099988-77100010 CTGCACAATTAGAGTAGAGAAGG - Intronic
1160275116 18:77425219-77425241 CTGCAGTAATAGCAAAGACATGG - Intergenic
1160322674 18:77911138-77911160 CTGCAGATCCAGAGAAGAGAGGG - Intergenic
1160348977 18:78158593-78158615 CTGCTGAAAGAGAGAAGCCAGGG - Intergenic
1161357060 19:3825075-3825097 CTGCAGGAATAAGGGAGAGACGG + Intronic
1161597382 19:5157527-5157549 CAGCAGACATGGAGAAGAGGAGG - Intergenic
1162238814 19:9331037-9331059 GTGGAGAGAGAGAGAAGAGAAGG - Intronic
1162409754 19:10498505-10498527 CTATAGAAATTGACAAGAGAGGG - Intronic
1164571342 19:29376827-29376849 AGGCAGAAACAGAAAAGAGATGG + Intergenic
1164687977 19:30182697-30182719 CTTCAAAAAAATAGAAGAGAAGG + Intergenic
1165306365 19:35005280-35005302 TTGCAGAAAGAGAGCAGGGAGGG + Intronic
1165462795 19:35953933-35953955 CTCCAGAAATGGAGAAGCAAGGG - Intergenic
1165611178 19:37154738-37154760 CTGCAGAAAACAAAAAGAGAGGG + Intronic
1166136310 19:40779010-40779032 CTCAACAAATATAGAAGAGAAGG + Intronic
1166822215 19:45587586-45587608 CTGGAGGGCTAGAGAAGAGAGGG - Intronic
1167136634 19:47620199-47620221 CTGCAGAAGATGAGAAGGGAGGG + Intronic
1168171188 19:54590745-54590767 GTCCACAAATACAGAAGAGAGGG + Intronic
1168463155 19:56578661-56578683 CTGCAGAAATCCAGATGAGATGG - Exonic
924968424 2:100443-100465 CTGCAGAAAAAGACAAGACAAGG + Intergenic
925251463 2:2442426-2442448 CTGCAGAAATACAGACCAGGTGG + Intergenic
925885045 2:8388177-8388199 GTGCAGAAATGGAGAAAACAAGG + Intergenic
925937968 2:8785751-8785773 CTGCACAAATTGAAAAGTGAAGG - Exonic
926173640 2:10569882-10569904 GCGTAGAAACAGAGAAGAGAAGG + Intergenic
927546758 2:23960933-23960955 CTGTAGAAATAGAAAGCAGACGG - Intronic
928236321 2:29544511-29544533 CAGCAGAAATAGATTAGAGGAGG - Intronic
928738785 2:34324557-34324579 CTAAAGAGATAGAGAAGAAAAGG - Intergenic
928941639 2:36732976-36732998 ATACAGAAATAGAGAATAGAAGG + Intronic
929123796 2:38504500-38504522 ATTCAGAAATACAGATGAGAAGG - Intergenic
929845415 2:45520671-45520693 CAGCAGAGAAAGAGGAGAGAAGG + Intronic
930919857 2:56739412-56739434 TTGAAGAAAGAGAGAAGGGAGGG - Intergenic
931258055 2:60591394-60591416 CTTCAGAAAAATTGAAGAGAAGG + Intergenic
931271900 2:60710993-60711015 CTGCAGGAAAGGAGAAGAGAAGG - Intergenic
932703302 2:74004976-74004998 CTGGAGATACAGAGGAGAGAGGG - Intronic
933288454 2:80409508-80409530 CAGCAGAAAGTGAGAGGAGATGG + Intronic
933306467 2:80606081-80606103 CTGCAGATGTTGAGAAGAGTTGG + Intronic
933622915 2:84564343-84564365 CTGCTGAAATAAATCAGAGATGG - Intronic
934118711 2:88819753-88819775 ATGCAGAAATCGTGAACAGAGGG + Intergenic
935528361 2:104200829-104200851 CTGAGGAAAAAGAGAAGAGAAGG + Intergenic
935547003 2:104410958-104410980 CTGAAGAAATAGAAGTGAGATGG + Intergenic
935740420 2:106142662-106142684 GGGCAGAAAGAGTGAAGAGATGG + Intronic
936155592 2:110045173-110045195 CTCCAGAAAAAGAGAAGAGCAGG + Intergenic
936164167 2:110105477-110105499 CTGCAGGAGAACAGAAGAGAAGG + Intronic
936189096 2:110326261-110326283 CTCCAGAAAAAGAGAAGAGCAGG - Intergenic
936947860 2:117946635-117946657 CAGAGGAAAGAGAGAAGAGATGG + Intronic
937076428 2:119110623-119110645 CTGCACAGGTAGAGAAGACAAGG + Intergenic
937152574 2:119696082-119696104 CTGCAGCCACAGAGATGAGATGG - Intergenic
937278085 2:120698955-120698977 CTGTAGAAAGTGAGAAGAGAGGG - Intergenic
938386288 2:130869636-130869658 CTGCAGTTAGAGAGAAGAGAGGG + Intronic
938525855 2:132130035-132130057 CTGGAGATATAAAGAAGAGCTGG + Intergenic
938959200 2:136325831-136325853 ATGAAGAATGAGAGAAGAGAAGG - Intergenic
941198298 2:162477474-162477496 CTTCAGAGATAGAATAGAGAAGG + Intronic
941724350 2:168845018-168845040 ATGCAGAATTAGAGAAGAAAGGG + Intronic
942018327 2:171840623-171840645 CAGCAGAAATAGAAAATAGAAGG + Intronic
942187188 2:173435098-173435120 CTGAAGTAATAGGAAAGAGAGGG - Intergenic
942469257 2:176242715-176242737 CTGCAGAGATCCTGAAGAGATGG + Intergenic
942497922 2:176559055-176559077 CTCCTGAAACTGAGAAGAGAGGG - Intergenic
943583148 2:189708019-189708041 CTTCAGAAATAGAAAGGAGAGGG + Intronic
943934404 2:193896881-193896903 GTGGAGACAGAGAGAAGAGATGG - Intergenic
944089620 2:195891430-195891452 CTGGAGGAATACAGAAGAGAGGG - Intronic
944301150 2:198126424-198126446 TTGCAGAAAATGAGAAAAGATGG + Intronic
944373728 2:199015076-199015098 CTGCAGAAAGTGAGAAAATAAGG - Intergenic
944500962 2:200359887-200359909 CTGTAGAAGTTCAGAAGAGAAGG - Intronic
945179170 2:207074474-207074496 CTTCAGACCCAGAGAAGAGAGGG - Exonic
945231014 2:207589969-207589991 TTCCAGAAAAAGAGAAGGGAAGG - Intronic
945318282 2:208393560-208393582 CAGGAGAAAAAGAGGAGAGAGGG - Intronic
945538212 2:211047470-211047492 ATGAAAAAAGAGAGAAGAGAAGG + Intergenic
946135892 2:217646619-217646641 CTTCAGATATGGAGCAGAGATGG + Intronic
946613174 2:221481059-221481081 CTGGAGAGTTAGAGAGGAGAAGG - Intronic
947179389 2:227398735-227398757 CTGCAGAAATATATAATAGCAGG - Intergenic
948466676 2:238155534-238155556 CTGGAGGAAGAGAGAAGAGTGGG + Intergenic
1169417618 20:5431458-5431480 CTGCAGAATCTGAGGAGAGAAGG + Intergenic
1169810065 20:9600880-9600902 CTCCAGAAAAAATGAAGAGAAGG - Intronic
1170214426 20:13876664-13876686 CTCCAGCAGTAGAGCAGAGAAGG + Intronic
1170272068 20:14538344-14538366 CTGGAGCAATGGAGGAGAGATGG + Intronic
1170329372 20:15191430-15191452 CTGCAGTTATAGTGAAGAGGTGG + Intronic
1170674224 20:18464354-18464376 CTACAGAAATAAAGCAGTGAGGG - Intronic
1170710815 20:18788939-18788961 TTGAAGAGATAGAGAAGAGGTGG + Intergenic
1170757928 20:19221226-19221248 CTGCACATATTGAGAGGAGATGG - Intronic
1170816933 20:19721532-19721554 TTGAAGAAATAGAGAGGAGGGGG + Exonic
1171074137 20:22104903-22104925 CTGGAGAAATATAGACGATAAGG - Intergenic
1173095005 20:40017708-40017730 TTGCAGAAACAGAGACAAGAGGG - Intergenic
1173180426 20:40802710-40802732 ATGCAGAAAGAGATAAGACAGGG - Intergenic
1173535560 20:43809700-43809722 TCTCAGAAGTAGAGAAGAGAAGG - Intergenic
1173893082 20:46528595-46528617 GGGCAGAAATAAGGAAGAGAGGG - Intergenic
1174149300 20:48474902-48474924 CTGGAGAACTGGAGAGGAGATGG - Intergenic
1174212955 20:48894462-48894484 CTCCAGAAATACAGACGTGAAGG + Intergenic
1174217848 20:48930894-48930916 CAGACGAAATAGAGCAGAGATGG + Intronic
1174257748 20:49270877-49270899 CTGCAGGAAAAGAGGCGAGAGGG - Exonic
1174761142 20:53208337-53208359 ATACAGAAATGGAGAAGACAGGG + Intronic
1175101216 20:56580112-56580134 CTGTAGAAATGGAGGAGGGAAGG + Intergenic
1175631471 20:60541574-60541596 CAGCAGAAATGCAAAAGAGATGG - Intergenic
1176770669 21:13069827-13069849 CTGGAGATATAAAGAAGAGCTGG - Intergenic
1177726650 21:24977381-24977403 CTCCAGAAAAACAGAAGAAATGG + Intergenic
1177781312 21:25625341-25625363 ATGCAGAAAGAGGGAAGGGAGGG + Intergenic
1177798319 21:25802207-25802229 ATGCAGAAATAGTGGATAGATGG + Intergenic
1178038614 21:28613593-28613615 ATGCAGAAAGAAAGGAGAGAAGG - Intergenic
1178111568 21:29374956-29374978 CCTCAGAAAGAGAGAAGAGCCGG + Intronic
1178949323 21:36973577-36973599 CTGCAGAAAGATGGAAGGGATGG - Intronic
1179443935 21:41418473-41418495 GAGCAGGAATAAAGAAGAGAGGG + Intergenic
1180618624 22:17145295-17145317 CTGCACAGGTAGAGTAGAGAGGG + Intronic
1181052549 22:20244636-20244658 GTGTAGAAAGAGAGCAGAGAGGG - Intronic
1181568077 22:23751610-23751632 CCACAGAAATAGAGATGAGAAGG + Intergenic
1181621429 22:24094138-24094160 CTGCAGGAACAGAGAGGAGCTGG + Intronic
1181967263 22:26665956-26665978 GTGCTGAAACTGAGAAGAGAAGG - Intergenic
1182342499 22:29635132-29635154 CTGCAAACACAGAGAAGGGATGG + Intronic
1182453120 22:30432853-30432875 CTGGAGAAATAAGGAAGTGAGGG + Intergenic
1182621829 22:31622673-31622695 CTGAAGGAAGAGAGAACAGAGGG - Intronic
1182916625 22:34039052-34039074 CTGCAGTAACAGAGGAGAGTTGG + Intergenic
1183172727 22:36199682-36199704 ACGCAGAAATAGAGATGGGAAGG + Intronic
1183197603 22:36364257-36364279 CTGCAGGACTAGAGGTGAGATGG - Intronic
1184706195 22:46215150-46215172 CTGGGGAAAAAGAGGAGAGACGG - Intronic
1184891835 22:47384424-47384446 CTGCGGATATAGAGAAGAATGGG - Intergenic
1185236825 22:49718747-49718769 CTGGAGAATGAGAGAGGAGAGGG - Intergenic
950170624 3:10836924-10836946 CTGCAGGAATAGAGAATAGTTGG + Intronic
950412945 3:12850824-12850846 CGGCAGAAATGGAGAAGACATGG - Intronic
950617367 3:14171871-14171893 CTAGAGAAAAGGAGAAGAGATGG + Intronic
951092683 3:18593139-18593161 TTGCAGAAGTAGAGAAAAAAAGG + Intergenic
951607613 3:24453161-24453183 CTACTGAAATAGACAAGAGTTGG - Intronic
951688649 3:25372523-25372545 CTGCAGAAAGAGAAATGAGCTGG + Intronic
951819599 3:26793402-26793424 CTGCAGAAAAAGGGAACAGGAGG + Intergenic
951825510 3:26863982-26864004 ATGAAGAAGTAGAGAAGAGGAGG + Intergenic
951973154 3:28471725-28471747 TAGCACAATTAGAGAAGAGAAGG + Intronic
951983349 3:28589857-28589879 CTGCTGAAATGGAGGAGAGAAGG - Intergenic
952307955 3:32162024-32162046 CTATAGCAATGGAGAAGAGAAGG - Intronic
953295209 3:41708479-41708501 ACTCAGAAGTAGAGAAGAGATGG + Intronic
953458380 3:43062025-43062047 CTGCAGAAATAGTGATGTGTTGG + Intergenic
953747287 3:45584984-45585006 TTGGAAAAACAGAGAAGAGAGGG - Intronic
953970987 3:47346625-47346647 CTGATGAAATCCAGAAGAGAAGG - Exonic
954106534 3:48412621-48412643 CTGCAGCCAAAGAGAAGGGATGG + Intronic
954193497 3:48981637-48981659 CTGCAACAGGAGAGAAGAGAAGG - Intronic
955776641 3:62440709-62440731 GAGCAGAAATAGGGAAGAGGGGG + Intronic
955851483 3:63224725-63224747 CTGGAGAAATTGAGGAGAGAAGG + Intergenic
956541418 3:70344299-70344321 CCAGAGAAAGAGAGAAGAGAAGG + Intergenic
956861458 3:73327924-73327946 TTGTAGAAATAGAGAGGAGGAGG - Intergenic
956876133 3:73465436-73465458 CTGCAGAATTAGAGAAGATTTGG + Intronic
957248285 3:77739871-77739893 CAGGAGCAAGAGAGAAGAGAAGG + Intergenic
957251432 3:77775925-77775947 CTGCAGAAATGGTGCAGAAAGGG + Intergenic
957695423 3:83632071-83632093 CTGAAAAAATAAAGAATAGATGG + Intergenic
958521761 3:95198723-95198745 AAGAAGAAATAGAGAAGAAAAGG - Intergenic
959180912 3:102979494-102979516 CTGCTGTAAGAGAGAAGAGGTGG + Intergenic
959218936 3:103490535-103490557 CTGCAAGAATAGGGGAGAGAGGG - Intergenic
959355142 3:105317370-105317392 ATGAAGAAATAGGGAAAAGATGG - Intergenic
960061758 3:113330119-113330141 AAGCTGAAAGAGAGAAGAGAAGG - Intronic
960465310 3:117990432-117990454 CTTCTGAAATAGAGAAAAGAGGG + Intergenic
960547128 3:118928360-118928382 ATGGAGAAGGAGAGAAGAGATGG + Intronic
961200115 3:125038806-125038828 CTGGAGAAATGGAAAGGAGACGG + Intronic
961228399 3:125276071-125276093 CACCAGAAATAGATAACAGAAGG - Intronic
961805099 3:129483646-129483668 CGGCAGAAATGGAGAAGACATGG - Exonic
962732826 3:138299256-138299278 CTGCAGAGATAGAGAAAAGGTGG - Intronic
963120169 3:141769608-141769630 CTGCAGATACAGATCAGAGAAGG - Intergenic
963263269 3:143214083-143214105 CTGTAGACCTAGAGTAGAGATGG - Intergenic
963370036 3:144387418-144387440 CTTCAGCAACAGAGAAGAGCAGG - Intergenic
963560240 3:146855429-146855451 TTGCAGAAGTGGAGAAGAGATGG - Intergenic
963721217 3:148864419-148864441 CTGAGGACAGAGAGAAGAGAAGG + Intergenic
963725355 3:148914136-148914158 ATGCACAAACAGAGAAAAGAAGG + Intergenic
964301809 3:155296120-155296142 CTGCAAAAATAGAGGAGTGGGGG + Intergenic
964317116 3:155456668-155456690 TTCCTGAAATGGAGAAGAGAAGG - Intronic
964582902 3:158260120-158260142 CTTCAGAAAAGGAGAAGAAAAGG - Intronic
965332033 3:167387635-167387657 GTGGAGAAAGAGAGAAGAGGTGG + Intergenic
965514545 3:169606788-169606810 CTGCAGGAAGGGAGAAAAGAGGG + Intronic
965987466 3:174773224-174773246 GTATAGAAATAGAGAGGAGAAGG + Intronic
966415677 3:179687314-179687336 CAGCAGGAATGGAGAAGACAGGG - Intronic
966589974 3:181671501-181671523 ATGTAGAAAATGAGAAGAGATGG + Intergenic
966903502 3:184505110-184505132 CTGCAGAAAGAAGGAACAGAAGG + Intronic
968627518 4:1633872-1633894 CTGCAGGAAAAGAGAAAAGGGGG + Intronic
969247683 4:5945978-5946000 CTGGAGAAAGGGAGGAGAGAAGG + Intronic
969353683 4:6612942-6612964 CTGCAGACAGAGAGAAGTGCAGG - Intronic
969926366 4:10589593-10589615 CTGCAGAAACAAAGCAGGGAGGG + Intronic
971990079 4:33881193-33881215 CTCCAGAAATAGAGACTAGGAGG - Intergenic
972283045 4:37621635-37621657 CTGCAGAAATTGAGCAGTGTTGG - Intronic
972308323 4:37853869-37853891 CTGCAGAAATGGAGAAGAGGTGG + Intronic
972406495 4:38751487-38751509 CGGCAGAAAGAGAGAAGAGGAGG + Intergenic
973058276 4:45687567-45687589 CTGAAGAAATTGACAAGAGGAGG + Intergenic
974318832 4:60317300-60317322 CTGCTGTAATAGAGTAGACAAGG - Intergenic
974381883 4:61151293-61151315 GTGCACTAATAGAGAATAGAGGG - Intergenic
975873434 4:78807452-78807474 CTCCAAAAAAATAGAAGAGAAGG - Intronic
977766896 4:100809225-100809247 ATGCATAAAAAGAAAAGAGATGG - Intronic
977830550 4:101586357-101586379 CTGGAGAAATAGAAAGCAGAGGG - Intronic
978352744 4:107837498-107837520 CAGCAGAAGTAGGCAAGAGATGG + Intronic
979199361 4:117958422-117958444 CTGAAAAAACTGAGAAGAGATGG + Intergenic
979734916 4:124071910-124071932 AGGCAGCAATAGAGAAAAGAAGG + Intergenic
979930502 4:126624245-126624267 CTGCAAAAGTGGAGAAGACAGGG + Intergenic
980501326 4:133657987-133658009 CAGCAGAAATGGAAAAGAAATGG + Intergenic
981004686 4:139862629-139862651 CTACAGAGATAGTGAAGAGGAGG - Intronic
981651946 4:147070185-147070207 CAGTAGAAATAGAGAGGAAAAGG + Intergenic
983119099 4:163858393-163858415 CTGCACAACTAGATAAGATATGG - Intronic
984179073 4:176458732-176458754 AGGCAGAAATAGAGAGGGGAAGG + Intergenic
984414424 4:179438601-179438623 CTACAGAGATAAAGCAGAGATGG + Intergenic
984588883 4:181594609-181594631 CTGCTTAAATAGAGCATAGATGG - Intergenic
984960738 4:185094991-185095013 CTGTATAAACACAGAAGAGAAGG + Intergenic
986329387 5:6706285-6706307 CGGGAGAAATAGAGAAGGGAAGG + Intergenic
986353373 5:6901200-6901222 CTGAAGAAATAAAAAACAGATGG - Intergenic
987244020 5:16029944-16029966 CTGCTAAAATAGAAAACAGATGG - Intergenic
987451626 5:18091639-18091661 CTTTAGAAATAGACTAGAGAGGG + Intergenic
988429949 5:31108033-31108055 CCGCTGAAACACAGAAGAGAAGG - Intergenic
988482883 5:31644298-31644320 CTTTAGAAATAGAGAAAAGATGG + Intronic
990574785 5:57113939-57113961 CTGCAGAGATATAGAAGAAGAGG - Intergenic
990630963 5:57668283-57668305 CTGCAGAAATGGAGAAAACTGGG + Intergenic
991509106 5:67357199-67357221 CTGGAGAAATACTGAAGAGATGG - Intergenic
991538517 5:67700445-67700467 CTGGAGAGAGAGAGAGGAGAGGG - Intergenic
992363956 5:76072515-76072537 CTGCAGAATTACAGTAGAGAAGG + Intergenic
992477304 5:77116410-77116432 TTACAGAAATACAAAAGAGATGG + Intergenic
992534599 5:77686348-77686370 TTGCAGAAATAGTTAAGATAAGG - Intergenic
992896925 5:81253598-81253620 AGGCAGCCATAGAGAAGAGAGGG + Intronic
993015398 5:82530100-82530122 CTGCAGGAAAAGAGAAAGGAGGG - Intergenic
993289332 5:86044189-86044211 CAGCAGAAATAGTGAAAATATGG - Intergenic
994114540 5:96047365-96047387 CTTCAAAAATAAAGAACAGAGGG - Intergenic
994139835 5:96330033-96330055 CTGGAGAAAAAGACAAGAGATGG - Intergenic
994990395 5:106989102-106989124 CTGCAGAATTAGTGCAGACATGG + Intergenic
995437795 5:112157629-112157651 CAGGAGAAATAGACATGAGAGGG - Intronic
995600955 5:113795391-113795413 ATGAAAAAATAAAGAAGAGAAGG - Intergenic
995679636 5:114702604-114702626 CTGTGGAAATAGATAACAGAAGG + Intergenic
996309506 5:122088650-122088672 CTGCAGAAGTAGTCAAGAGTGGG - Intergenic
996577078 5:124987582-124987604 TTGCAGACATAGAGAAGGGATGG + Intergenic
996772648 5:127101347-127101369 CAGTAGAATTAGAGAGGAGAAGG - Intergenic
996788122 5:127262922-127262944 TGGTAGAAATAGAGATGAGAGGG + Intergenic
996977933 5:129457600-129457622 GTGGTGAAATAGAGAAGAAAAGG - Intergenic
997042983 5:130279110-130279132 CAGCAGCAATAGGGAATAGAGGG + Intergenic
997866485 5:137468221-137468243 CTGCAGTTAAAGAGAACAGAGGG + Intronic
998472366 5:142393045-142393067 CTGTAACAACAGAGAAGAGAGGG - Intergenic
998587664 5:143444506-143444528 TGGCAGAAATACAGAAGACAGGG + Intergenic
998900037 5:146843409-146843431 CTGCAGTGATAGAGTAGATAAGG + Intronic
999407482 5:151319769-151319791 CTGCATAAATGAAGAAGAGTGGG + Intronic
1000501039 5:162050425-162050447 ATGCAGACATAAAGAACAGATGG - Intergenic
1000843984 5:166256570-166256592 CTGCAGAGATAAAGAAGAACTGG + Intergenic
1002490838 5:179576075-179576097 TTGCAGAAATATAGAAAAGCTGG - Intronic
1002766747 6:247028-247050 CTCCAGAGAAAGGGAAGAGAAGG + Intergenic
1003088396 6:3079991-3080013 AAGCAGAAAGAGAGGAGAGAGGG + Intronic
1004098428 6:12583017-12583039 CTGGAGAAATAGAAAAGAATTGG - Intergenic
1004535595 6:16497940-16497962 GTGCAGGATTAGAGAAGAGATGG + Intronic
1004945787 6:20611074-20611096 CTGCAGAGAAAGAAAACAGATGG - Intronic
1005222542 6:23603298-23603320 ATGAAGGAAAAGAGAAGAGAAGG + Intergenic
1006030885 6:31175780-31175802 CTGCAGAAGGAGAGAAGGGAAGG - Intronic
1006272720 6:32976539-32976561 CTGCAGAAAGAAACAAGATAGGG - Intronic
1006805614 6:36787166-36787188 ATGGAGAAAGAGAGATGAGAAGG - Intronic
1006847687 6:37074205-37074227 CTGCTGAAATGGAGGAGGGATGG + Intergenic
1006887227 6:37392190-37392212 CTGGAAAAATAGAGAACAAAAGG + Exonic
1007724296 6:43905534-43905556 CTGCGGAAACATTGAAGAGATGG - Intergenic
1007918097 6:45579816-45579838 CTGCAGAAGCAGAGTAGAGCAGG + Intronic
1008012339 6:46481392-46481414 TTGAAGAAATACAAAAGAGATGG + Intronic
1008341832 6:50375556-50375578 TACCAGAAATAGAGAAGAAAGGG - Intergenic
1008620312 6:53264829-53264851 CCGAAGAAAGAGAGAAGATAAGG + Intergenic
1009572966 6:65413029-65413051 CTGGGGAAATTGAGAAGTGATGG - Intronic
1009958453 6:70486955-70486977 CTGCAGAAATAGAGAAGAGATGG + Intronic
1010089326 6:71961389-71961411 ATACAGAAAGAGAGGAGAGAAGG - Intronic
1010175037 6:73018094-73018116 ATGCAGAAATAGAGAAGGGCCGG + Intronic
1010503816 6:76632213-76632235 CAGCAGAAACAGAGACGAGGAGG - Intergenic
1010544127 6:77128874-77128896 CTGCTGAAATAAACCAGAGATGG + Intergenic
1012241253 6:96875505-96875527 CAGTAGAAATGGAGAAAAGATGG - Intergenic
1012323202 6:97878155-97878177 CTGGAGAAATAGAGGAGATAAGG - Intergenic
1013364711 6:109428015-109428037 CACCAGAGATAGGGAAGAGAAGG + Intronic
1013464563 6:110406474-110406496 CTGTAGAAACAGAGAGTAGATGG - Intronic
1013488461 6:110620675-110620697 CTACATAGATAAAGAAGAGAAGG - Intronic
1014443442 6:121499215-121499237 CTTCAGAAATATAAAAGAAATGG - Intergenic
1014639818 6:123895135-123895157 CTGAGGAAAGAGAGAAGAAAGGG - Intronic
1014655944 6:124104153-124104175 CTGGAGAAATAGGGGAGCGAAGG - Intronic
1014736671 6:125101967-125101989 CTGAAGACATAAAGAAAAGATGG + Intergenic
1014851152 6:126340888-126340910 ATGCGTAAATAGAGGAGAGACGG - Intronic
1014855006 6:126389472-126389494 TTGCAGAAATGGAAAAGAAAAGG - Intergenic
1015340045 6:132088384-132088406 CTAAAGAAATGGAGCAGAGAGGG + Intergenic
1015925693 6:138308342-138308364 ATGCAGAAAAAGAGCACAGAAGG - Intronic
1016057078 6:139589469-139589491 CTGCTGAACTAGAAAAGAGATGG + Intergenic
1017969005 6:159293872-159293894 CTTCAAAAAGATAGAAGAGAAGG - Intergenic
1019398439 7:836233-836255 CTGCAGAGAGAGAGGAGGGAAGG + Intronic
1019860216 7:3651825-3651847 GAGCAGTAATAGAGAACAGAGGG + Intronic
1020100880 7:5393824-5393846 CTGCAGAAATGCAGAAGAAAAGG + Intronic
1020816236 7:12909297-12909319 CTACAGAGAAAGAGAAGAGAAGG + Intergenic
1020875820 7:13692211-13692233 CTGTAGAAATAGAGATGAAAAGG + Intergenic
1021546502 7:21819157-21819179 TTGAAGAAAAAAAGAAGAGAGGG - Intronic
1022237981 7:28480439-28480461 CTGGAAAAATAGAGATGACAGGG + Intronic
1022461155 7:30608525-30608547 CTGTAGAAATAGAGTCTAGAAGG + Intronic
1022616376 7:31935173-31935195 ACACAGAAATAGTGAAGAGAAGG + Intronic
1023003057 7:35831167-35831189 CTGCTGAAATATAGAAAATAAGG - Intronic
1023610022 7:41963503-41963525 CTGCAGTTAGAGAGAAGGGACGG - Exonic
1023839581 7:44088774-44088796 GTGCAGGAATAGATCAGAGAAGG - Intergenic
1024437006 7:49368858-49368880 CTGGAAAAATATACAAGAGAGGG - Intergenic
1025932926 7:66010842-66010864 CTGGAGACAGAGAGAGGAGAAGG + Intergenic
1025950457 7:66141411-66141433 CTGGAGACAGAGAGAGGAGAAGG - Intronic
1026117625 7:67509279-67509301 CTGCAGACATAGAAAAGCAAGGG - Intergenic
1026730891 7:72910924-72910946 CTGGAAAGGTAGAGAAGAGAAGG - Intronic
1027113196 7:75457245-75457267 CTGGAAAGGTAGAGAAGAGAAGG + Intronic
1027269369 7:76511634-76511656 CTGCAGGAGGAGAGAACAGATGG - Intronic
1027285446 7:76641840-76641862 CTGGAAAGGTAGAGAAGAGAAGG + Intergenic
1027320080 7:77005527-77005549 CTGCAGGAGGAGAGAACAGATGG - Intergenic
1027449022 7:78308387-78308409 ATGCAGAAATAGAACAGAAAAGG - Intronic
1029169231 7:98618624-98618646 TTTCAGAGATAGAGATGAGACGG - Intronic
1029236125 7:99120598-99120620 CTCTAGAAATAAAGAAGACAGGG - Intronic
1030026525 7:105329704-105329726 CTGTAGAAAAACAGAAGAAAGGG + Intronic
1030078049 7:105753619-105753641 CTGCTGTAATGGAGAGGAGAGGG - Intronic
1030687317 7:112500197-112500219 CTGAGGCAATAGAGAAGAGAAGG - Intergenic
1030963242 7:115953523-115953545 CTGCAGACACAGAAGAGAGAAGG + Intronic
1031362535 7:120864273-120864295 CTGCCGAAATGGAGATGAGCTGG + Intergenic
1031529209 7:122855873-122855895 CTGGAGGAAAAGAGAGGAGAAGG - Intronic
1032510130 7:132465819-132465841 CTGCAGAGCTGGAGGAGAGAGGG + Intronic
1032655975 7:133929858-133929880 CTCTTGGAATAGAGAAGAGAAGG - Intronic
1032918372 7:136517620-136517642 TTTCAGAAATAGAGAACAGATGG - Intergenic
1033024657 7:137760627-137760649 CTCCAGAAATGGAGGAGAAAGGG + Intronic
1033704887 7:143876800-143876822 CTGCAGAATTTAAGAGGAGAGGG - Intronic
1033809459 7:144993952-144993974 CGGCAGACAAAGAAAAGAGAAGG - Intergenic
1034006416 7:147477112-147477134 CTCCAGTAAAAGAGATGAGATGG + Intronic
1034010427 7:147523617-147523639 CTGCAGAAGCAGAGAGGAGGAGG - Intronic
1035569298 8:661376-661398 CTGCAGAGCCTGAGAAGAGAGGG - Intronic
1036110423 8:5894062-5894084 CTGCAGATATTGACAAAAGAAGG + Intergenic
1036127651 8:6078024-6078046 CTGCAGAAACAGAGAATAAGAGG + Intergenic
1036465606 8:8994170-8994192 CTGCAGAAGTTGTGGAGAGAGGG + Intergenic
1037130562 8:15403792-15403814 GTGCAGTAATCAAGAAGAGATGG + Intergenic
1037182230 8:16021509-16021531 CTGCAGAAACAGAGATCAGTTGG - Intergenic
1037211413 8:16392840-16392862 CTGCTGAAAGTAAGAAGAGATGG - Intronic
1037502659 8:19500359-19500381 GTGCAGAAATAAGGAAGAGTGGG - Intronic
1037801747 8:22039812-22039834 CTGCTGAAAAACAGAAGAGTTGG - Intergenic
1038519486 8:28217870-28217892 ATGCAGAAATAAAAAAGATACGG + Intergenic
1038535964 8:28352930-28352952 CTGCAGAAACACAGGAAAGAAGG + Intronic
1040389280 8:46935774-46935796 CTGCAGGAATACAGAGGAGCAGG - Intergenic
1041036518 8:53796988-53797010 ATCCAAAAATAGAGAAGACAAGG - Intronic
1041168697 8:55117988-55118010 CTGCAGAACTAGAAAAGATCCGG - Intronic
1041327386 8:56682752-56682774 CTGCAGAAAAGCAGAAGGGAAGG + Intergenic
1041548774 8:59077327-59077349 CTGCATACTTAGAGAAGAAAGGG - Intronic
1041568246 8:59305134-59305156 CTGCAGAGTAAGGGAAGAGAAGG - Intergenic
1041669950 8:60481993-60482015 CAGGAGAAATAGAGAAGACTAGG + Intergenic
1041693046 8:60708418-60708440 CTGCAGGAGTCCAGAAGAGAAGG - Intronic
1041937907 8:63355356-63355378 CTGAAGAAATAGGGAAAAGTGGG - Intergenic
1042392397 8:68251012-68251034 ATTCAGAAACAGAGAATAGAAGG + Intergenic
1042724795 8:71861809-71861831 AAGCAGAAATAGAGGAGAAAAGG - Intronic
1043278916 8:78438465-78438487 CAGCAGGAAGAGAGAAGAAAGGG - Intergenic
1043880484 8:85536822-85536844 ATGCAGAAATAGAAAAGTGGGGG + Intergenic
1043952465 8:86324691-86324713 CTGAATAAATAGCGAATAGATGG + Intergenic
1044095491 8:88058871-88058893 CAGCAGAAATAGAGATGGAAAGG + Intronic
1044595580 8:93955297-93955319 CTGCAGAAACGTGGAAGAGAAGG - Intergenic
1044918853 8:97147016-97147038 TTGAAGTAAGAGAGAAGAGATGG + Intronic
1045220618 8:100195914-100195936 CTATAGGAATAGAGAAGAGCTGG - Intronic
1045449312 8:102305480-102305502 CGACAGGAATAGAGAAGGGAGGG + Intronic
1045481273 8:102594026-102594048 CGGCAGAGAGAGAGAAGAGGAGG + Intergenic
1045604563 8:103757762-103757784 GTGCACAAACACAGAAGAGAAGG + Intronic
1045817385 8:106292685-106292707 GAGCAGTAATAGAAAAGAGAAGG + Intronic
1046023092 8:108689868-108689890 CTGGAGAAATGGAGAGGAGGGGG - Intronic
1046341347 8:112860848-112860870 TTGAACAAATAGAAAAGAGAAGG - Intronic
1047109057 8:121768305-121768327 TTGCAGAAATGGAGGAGTGAGGG - Intergenic
1047193516 8:122700336-122700358 CTGCAGGGATAGAGAAGGCAGGG + Intergenic
1048053689 8:130843983-130844005 CTGAATAAATGGAGAAGAAAGGG + Intronic
1048176499 8:132157301-132157323 CTTCAAAAATAGGGAAAAGATGG - Intronic
1048292159 8:133189543-133189565 CTACAGGAAAAGAGAAGAGAAGG + Intergenic
1048504534 8:135008853-135008875 CTGGAGAATGAGAGGAGAGAGGG + Intergenic
1048514810 8:135096618-135096640 CAACAGAAATGGAGTAGAGATGG + Intergenic
1048842285 8:138576679-138576701 ATGCAGAAAGAGAGGGGAGAGGG + Intergenic
1048846959 8:138611190-138611212 CTCCAGAAATGGAGAAGACCTGG + Intronic
1049839434 8:144761632-144761654 CAGGAGGAAGAGAGAAGAGAGGG - Intergenic
1049867508 8:144948374-144948396 CAGCAGAAATGGAGGAGACATGG + Intronic
1050112912 9:2235071-2235093 CTGCCGTAATACAGAAGAGCAGG - Intergenic
1050113981 9:2244036-2244058 ATACAGAAAGAGAGAAGACATGG + Intergenic
1050172485 9:2836298-2836320 CTGGAGAAAAAGAGAATAAAAGG + Intronic
1050753535 9:8970262-8970284 CTGCAGATATACAGATGATATGG - Intronic
1051173060 9:14338943-14338965 TTGCCTAAATAGAGAAAAGATGG + Intronic
1051489084 9:17641258-17641280 CTCCAGGAATAGTGAGGAGATGG - Intronic
1052062594 9:23979086-23979108 CTGGAGAAAGAAAGAAGGGAGGG - Intergenic
1052301927 9:26961693-26961715 CTAAAGAAATAGATAATAGAGGG + Intronic
1052422565 9:28262782-28262804 CTAAAGAAATAGAGAATAGTTGG - Intronic
1053601923 9:39619621-39619643 CTGCAGATATTGAAAACAGAAGG + Intergenic
1053704547 9:40737383-40737405 CTGGAGATATAAAGAAGAGCTGG + Intergenic
1053859577 9:42373388-42373410 CTGCAGATATTGAAAACAGAAGG + Intergenic
1054251613 9:62722806-62722828 CTGCAGATATTGAAAACAGAAGG - Intergenic
1054414628 9:64860990-64861012 CTGGAGATATAAAGAAGAGCTGG + Intergenic
1054565724 9:66757323-66757345 CTGCAGATATTGAAAACAGAAGG - Intergenic
1054777925 9:69139465-69139487 GTGAAGACATAGAGAAAAGATGG + Intronic
1055723144 9:79198033-79198055 CTGCTAAAAGAAAGAAGAGAGGG - Intergenic
1055917258 9:81417379-81417401 CAGCAGAAAGAGCCAAGAGAGGG + Intergenic
1055981252 9:82003800-82003822 CTGGAAAAAGAGAGAAGAGGGGG - Intergenic
1056099216 9:83284772-83284794 CTACAGAAAGGGAGAAAAGAGGG + Intronic
1056550702 9:87651452-87651474 CGGCAGAAAAGGTGAAGAGACGG + Intronic
1056615675 9:88163568-88163590 CAGCAGAAATACAGTAGAGCAGG - Intergenic
1056697574 9:88872835-88872857 AGACAGAAATAAAGAAGAGAGGG + Intergenic
1057114290 9:92505961-92505983 CAGAAGCAAGAGAGAAGAGAGGG + Intronic
1057270456 9:93647387-93647409 CTGCAGAAGCAGGGAGGAGATGG + Intronic
1057705337 9:97391597-97391619 GTGCAGAATGAGAGGAGAGAGGG - Intergenic
1058170471 9:101674427-101674449 TAGCAGAAATGGAGAGGAGATGG + Intronic
1058305202 9:103432924-103432946 CAGAAGAAATGGAGAAAAGATGG - Intergenic
1058588580 9:106536548-106536570 CTGAAGAAATAGAGAAGGTCAGG - Intergenic
1058608700 9:106751921-106751943 CTGGAGAAACAGAGCAGAGAGGG + Intergenic
1058858980 9:109095886-109095908 CTGGAGAAAAAGAGACTAGAGGG + Intronic
1059418691 9:114177799-114177821 CTGCAGAATCAGAACAGAGAAGG - Intronic
1059875326 9:118628360-118628382 CTACTGAAATAGAGATGGGATGG - Intergenic
1059901461 9:118931217-118931239 TTGGAGACATAGAGAAGAAAAGG + Intergenic
1059971272 9:119671202-119671224 CCATAGAAATAGAGAATAGAAGG + Intergenic
1060049305 9:120366095-120366117 CTGCAGCCTTAGAGAACAGAAGG + Intergenic
1060297900 9:122355552-122355574 ATACAGAAAAGGAGAAGAGAAGG - Intergenic
1060373506 9:123097802-123097824 ATGCAGAAGAAGAGAAAAGACGG + Exonic
1061185891 9:129053070-129053092 GTACAGAAATAGGAAAGAGAAGG + Intronic
1186327867 X:8499118-8499140 ATGAAGAAAGAGAGAAAAGAAGG + Intergenic
1186503219 X:10068703-10068725 CTGCAGAGATGGAGATAAGATGG - Intronic
1186613263 X:11159481-11159503 ATGGAGAGAGAGAGAAGAGAGGG + Intronic
1187567035 X:20461021-20461043 CTGTAGAGATGGAGAACAGATGG - Intergenic
1187701538 X:21968304-21968326 CTCCAGAAACAGAGTAGAGAAGG - Intronic
1188563958 X:31503863-31503885 AGGCAGAAAAAGAAAAGAGAAGG + Intronic
1189076506 X:37920993-37921015 CTCCAGTAATAGAGAGGAAAGGG + Intronic
1189378734 X:40486281-40486303 CTGAAGAAAAAGAGGAAAGAAGG - Intergenic
1189455466 X:41184374-41184396 CTGGAAAAATAGAGAAGAGGGGG - Intronic
1189482759 X:41405855-41405877 TTACAGGGATAGAGAAGAGATGG + Intergenic
1189517088 X:41724047-41724069 CTACAGAAATAGAGAAATGAGGG + Intronic
1189960559 X:46320820-46320842 CTGGAGGTATAGAGATGAGAAGG + Intergenic
1190522141 X:51291194-51291216 CAGTAGAAAGAGAGAAAAGAAGG - Intergenic
1190631490 X:52391676-52391698 CTTCAGAAATATTTAAGAGATGG + Intergenic
1190635419 X:52427903-52427925 CTTCGGAAATAGTTAAGAGATGG - Intergenic
1190639389 X:52467893-52467915 CTTCAGAAATAGTTAAGAGATGG - Intergenic
1190742453 X:53298684-53298706 TTCCAGAAATAGAGAATGGAGGG - Intronic
1191607675 X:63079960-63079982 CTGCAAAAAGAGAACAGAGAAGG - Intergenic
1192216160 X:69160263-69160285 TTGGAGAGAGAGAGAAGAGAGGG + Intergenic
1192635930 X:72817572-72817594 CTGCAGAAACTGAGTATAGAAGG - Intronic
1192645784 X:72903231-72903253 CTGCAGAAACTGAGTATAGAAGG + Intronic
1193469373 X:81880383-81880405 CTGCAGCAGTAGAACAGAGATGG + Intergenic
1194037664 X:88898151-88898173 AGGAAGAAAGAGAGAAGAGAAGG - Intergenic
1194418535 X:93643573-93643595 AGGGAGAAATAGAGAGGAGAAGG + Intergenic
1194727610 X:97416738-97416760 ATGCAGAAGTAAAGAAGAAAAGG - Intronic
1195922684 X:109999107-109999129 TTTCAGAAATAGAGTAGTGATGG + Intergenic
1196157176 X:112443111-112443133 CTGCAGAGATAGAGAGTAGAAGG - Intergenic
1196504244 X:116422606-116422628 CAGTAGACATAGAGCAGAGAGGG + Intergenic
1196626605 X:117884412-117884434 CTGTGGAGATAGAGAATAGAAGG + Intergenic
1197129506 X:122988815-122988837 CTGTAGCAATGGAGAAAAGATGG - Intergenic
1198442158 X:136673636-136673658 TTTGAGAACTAGAGAAGAGAGGG - Intronic
1199396101 X:147340503-147340525 CTGCAGCAGTACAAAAGAGAAGG - Intergenic
1199430368 X:147752917-147752939 ATGCATAAAGTGAGAAGAGAAGG - Intergenic
1199670183 X:150139369-150139391 CTTCAGGAAAAAAGAAGAGAGGG - Intergenic
1199946180 X:152670061-152670083 CTGCTGGAATGAAGAAGAGAAGG + Intergenic
1200136277 X:153876173-153876195 GTGCAGACAGAGAGTAGAGAGGG - Intronic
1201050975 Y:9934928-9934950 CTGAAGAAACAGAGATGAGAAGG + Intergenic
1201067043 Y:10106831-10106853 CTACAGTAAAATAGAAGAGAAGG + Intergenic
1202163271 Y:21957664-21957686 CTGAAGGAATAGAGATGAGAAGG + Intergenic
1202169208 Y:22023265-22023287 CTTCAGAAATAAGGAAGAGTTGG + Intergenic
1202222153 Y:22563100-22563122 CTTCAGAAATAAGGAAGAGTTGG - Intergenic
1202228085 Y:22628704-22628726 CTGAAGGAATAGAGATGAGAAGG - Intergenic
1202315072 Y:23567472-23567494 CTGAAGGAATAGAGATGAGAAGG + Intergenic
1202320962 Y:23632567-23632589 CTTCAGAAATAAGGAAGAGTTGG + Intergenic
1202549805 Y:26037489-26037511 CTTCAGAAATAAGGAAGAGTTGG - Intergenic
1202555729 Y:26103121-26103143 CTGAAGGAATAGAGATGAGAAGG - Intergenic