ID: 1009959597

View in Genome Browser
Species Human (GRCh38)
Location 6:70501804-70501826
Sequence CAGTGCCAATGTGATGAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009959583_1009959597 26 Left 1009959583 6:70501755-70501777 CCCCACCCTGCTTCTACTCACCC 0: 3
1: 145
2: 388
3: 871
4: 2246
Right 1009959597 6:70501804-70501826 CAGTGCCAATGTGATGAACTGGG No data
1009959593_1009959597 2 Left 1009959593 6:70501779-70501801 CCGTGGGTTGGACTCACTGCCTA 0: 2
1: 12
2: 22
3: 121
4: 632
Right 1009959597 6:70501804-70501826 CAGTGCCAATGTGATGAACTGGG No data
1009959591_1009959597 6 Left 1009959591 6:70501775-70501797 CCCTCCGTGGGTTGGACTCACTG 0: 1
1: 4
2: 39
3: 420
4: 1334
Right 1009959597 6:70501804-70501826 CAGTGCCAATGTGATGAACTGGG No data
1009959585_1009959597 24 Left 1009959585 6:70501757-70501779 CCACCCTGCTTCTACTCACCCTC 0: 3
1: 147
2: 451
3: 814
4: 1416
Right 1009959597 6:70501804-70501826 CAGTGCCAATGTGATGAACTGGG No data
1009959586_1009959597 21 Left 1009959586 6:70501760-70501782 CCCTGCTTCTACTCACCCTCCGT 0: 2
1: 41
2: 251
3: 699
4: 1456
Right 1009959597 6:70501804-70501826 CAGTGCCAATGTGATGAACTGGG No data
1009959584_1009959597 25 Left 1009959584 6:70501756-70501778 CCCACCCTGCTTCTACTCACCCT 0: 3
1: 148
2: 411
3: 819
4: 1337
Right 1009959597 6:70501804-70501826 CAGTGCCAATGTGATGAACTGGG No data
1009959592_1009959597 5 Left 1009959592 6:70501776-70501798 CCTCCGTGGGTTGGACTCACTGC 0: 1
1: 3
2: 16
3: 62
4: 542
Right 1009959597 6:70501804-70501826 CAGTGCCAATGTGATGAACTGGG No data
1009959587_1009959597 20 Left 1009959587 6:70501761-70501783 CCTGCTTCTACTCACCCTCCGTG 0: 2
1: 42
2: 266
3: 684
4: 1396
Right 1009959597 6:70501804-70501826 CAGTGCCAATGTGATGAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009959597 Original CRISPR CAGTGCCAATGTGATGAACT GGG Intronic
No off target data available for this crispr