ID: 1009960088

View in Genome Browser
Species Human (GRCh38)
Location 6:70509188-70509210
Sequence CTGTGGAAGGTGGAGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009960079_1009960088 16 Left 1009960079 6:70509149-70509171 CCTGGCTGGGCACAGTGGCTCAC 0: 374
1: 1682
2: 4953
3: 8774
4: 10716
Right 1009960088 6:70509188-70509210 CTGTGGAAGGTGGAGGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009960088 Original CRISPR CTGTGGAAGGTGGAGGTGGG AGG Intronic
No off target data available for this crispr