ID: 1009969525

View in Genome Browser
Species Human (GRCh38)
Location 6:70612304-70612326
Sequence GTGGTGTGGAGGTGGGTAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009969525_1009969535 -2 Left 1009969525 6:70612304-70612326 CCCCCTACCCACCTCCACACCAC No data
Right 1009969535 6:70612325-70612347 ACCCCCTCTGCAGTCGGTCAAGG No data
1009969525_1009969533 -8 Left 1009969525 6:70612304-70612326 CCCCCTACCCACCTCCACACCAC No data
Right 1009969533 6:70612319-70612341 CACACCACCCCCTCTGCAGTCGG No data
1009969525_1009969537 -1 Left 1009969525 6:70612304-70612326 CCCCCTACCCACCTCCACACCAC No data
Right 1009969537 6:70612326-70612348 CCCCCTCTGCAGTCGGTCAAGGG No data
1009969525_1009969542 25 Left 1009969525 6:70612304-70612326 CCCCCTACCCACCTCCACACCAC No data
Right 1009969542 6:70612352-70612374 CAAGCCACCACTCCAGAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009969525 Original CRISPR GTGGTGTGGAGGTGGGTAGG GGG (reversed) Intergenic
No off target data available for this crispr