ID: 1009969537

View in Genome Browser
Species Human (GRCh38)
Location 6:70612326-70612348
Sequence CCCCCTCTGCAGTCGGTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009969527_1009969537 -3 Left 1009969527 6:70612306-70612328 CCCTACCCACCTCCACACCACCC No data
Right 1009969537 6:70612326-70612348 CCCCCTCTGCAGTCGGTCAAGGG No data
1009969530_1009969537 -9 Left 1009969530 6:70612312-70612334 CCACCTCCACACCACCCCCTCTG No data
Right 1009969537 6:70612326-70612348 CCCCCTCTGCAGTCGGTCAAGGG No data
1009969525_1009969537 -1 Left 1009969525 6:70612304-70612326 CCCCCTACCCACCTCCACACCAC No data
Right 1009969537 6:70612326-70612348 CCCCCTCTGCAGTCGGTCAAGGG No data
1009969529_1009969537 -8 Left 1009969529 6:70612311-70612333 CCCACCTCCACACCACCCCCTCT No data
Right 1009969537 6:70612326-70612348 CCCCCTCTGCAGTCGGTCAAGGG No data
1009969522_1009969537 13 Left 1009969522 6:70612290-70612312 CCCTACAAATCCAGCCCCCTACC No data
Right 1009969537 6:70612326-70612348 CCCCCTCTGCAGTCGGTCAAGGG No data
1009969526_1009969537 -2 Left 1009969526 6:70612305-70612327 CCCCTACCCACCTCCACACCACC No data
Right 1009969537 6:70612326-70612348 CCCCCTCTGCAGTCGGTCAAGGG No data
1009969523_1009969537 12 Left 1009969523 6:70612291-70612313 CCTACAAATCCAGCCCCCTACCC No data
Right 1009969537 6:70612326-70612348 CCCCCTCTGCAGTCGGTCAAGGG No data
1009969528_1009969537 -4 Left 1009969528 6:70612307-70612329 CCTACCCACCTCCACACCACCCC No data
Right 1009969537 6:70612326-70612348 CCCCCTCTGCAGTCGGTCAAGGG No data
1009969521_1009969537 22 Left 1009969521 6:70612281-70612303 CCGTTGATTCCCTACAAATCCAG No data
Right 1009969537 6:70612326-70612348 CCCCCTCTGCAGTCGGTCAAGGG No data
1009969524_1009969537 3 Left 1009969524 6:70612300-70612322 CCAGCCCCCTACCCACCTCCACA No data
Right 1009969537 6:70612326-70612348 CCCCCTCTGCAGTCGGTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009969537 Original CRISPR CCCCCTCTGCAGTCGGTCAA GGG Intergenic
No off target data available for this crispr