ID: 1009969542

View in Genome Browser
Species Human (GRCh38)
Location 6:70612352-70612374
Sequence CAAGCCACCACTCCAGAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009969524_1009969542 29 Left 1009969524 6:70612300-70612322 CCAGCCCCCTACCCACCTCCACA No data
Right 1009969542 6:70612352-70612374 CAAGCCACCACTCCAGAGTCAGG No data
1009969527_1009969542 23 Left 1009969527 6:70612306-70612328 CCCTACCCACCTCCACACCACCC No data
Right 1009969542 6:70612352-70612374 CAAGCCACCACTCCAGAGTCAGG No data
1009969531_1009969542 14 Left 1009969531 6:70612315-70612337 CCTCCACACCACCCCCTCTGCAG No data
Right 1009969542 6:70612352-70612374 CAAGCCACCACTCCAGAGTCAGG No data
1009969540_1009969542 0 Left 1009969540 6:70612329-70612351 CCTCTGCAGTCGGTCAAGGGAAC No data
Right 1009969542 6:70612352-70612374 CAAGCCACCACTCCAGAGTCAGG No data
1009969526_1009969542 24 Left 1009969526 6:70612305-70612327 CCCCTACCCACCTCCACACCACC No data
Right 1009969542 6:70612352-70612374 CAAGCCACCACTCCAGAGTCAGG No data
1009969532_1009969542 11 Left 1009969532 6:70612318-70612340 CCACACCACCCCCTCTGCAGTCG No data
Right 1009969542 6:70612352-70612374 CAAGCCACCACTCCAGAGTCAGG No data
1009969539_1009969542 1 Left 1009969539 6:70612328-70612350 CCCTCTGCAGTCGGTCAAGGGAA No data
Right 1009969542 6:70612352-70612374 CAAGCCACCACTCCAGAGTCAGG No data
1009969536_1009969542 3 Left 1009969536 6:70612326-70612348 CCCCCTCTGCAGTCGGTCAAGGG No data
Right 1009969542 6:70612352-70612374 CAAGCCACCACTCCAGAGTCAGG No data
1009969525_1009969542 25 Left 1009969525 6:70612304-70612326 CCCCCTACCCACCTCCACACCAC No data
Right 1009969542 6:70612352-70612374 CAAGCCACCACTCCAGAGTCAGG No data
1009969538_1009969542 2 Left 1009969538 6:70612327-70612349 CCCCTCTGCAGTCGGTCAAGGGA No data
Right 1009969542 6:70612352-70612374 CAAGCCACCACTCCAGAGTCAGG No data
1009969534_1009969542 6 Left 1009969534 6:70612323-70612345 CCACCCCCTCTGCAGTCGGTCAA No data
Right 1009969542 6:70612352-70612374 CAAGCCACCACTCCAGAGTCAGG No data
1009969529_1009969542 18 Left 1009969529 6:70612311-70612333 CCCACCTCCACACCACCCCCTCT No data
Right 1009969542 6:70612352-70612374 CAAGCCACCACTCCAGAGTCAGG No data
1009969530_1009969542 17 Left 1009969530 6:70612312-70612334 CCACCTCCACACCACCCCCTCTG No data
Right 1009969542 6:70612352-70612374 CAAGCCACCACTCCAGAGTCAGG No data
1009969528_1009969542 22 Left 1009969528 6:70612307-70612329 CCTACCCACCTCCACACCACCCC No data
Right 1009969542 6:70612352-70612374 CAAGCCACCACTCCAGAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009969542 Original CRISPR CAAGCCACCACTCCAGAGTC AGG Intergenic
No off target data available for this crispr