ID: 1009975192

View in Genome Browser
Species Human (GRCh38)
Location 6:70664537-70664559
Sequence CTACGCTACTTGCTTAAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009975187_1009975192 6 Left 1009975187 6:70664508-70664530 CCATCATTTGATTCTGTCTCTCC No data
Right 1009975192 6:70664537-70664559 CTACGCTACTTGCTTAAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009975192 Original CRISPR CTACGCTACTTGCTTAAAAT AGG Intergenic
No off target data available for this crispr