ID: 1009983619

View in Genome Browser
Species Human (GRCh38)
Location 6:70756521-70756543
Sequence TTGTGTGAGTAAAAGTATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 215}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009983619 Original CRISPR TTGTGTGAGTAAAAGTATGG AGG Intronic
901412113 1:9091703-9091725 TTATGTGAGTGGAAGTAAGGTGG - Intergenic
902080939 1:13820373-13820395 TTGTGTGAGTCACAGTAAAGAGG - Intronic
904071341 1:27800185-27800207 TAGTGTGAGCAAAGGCATGGTGG - Intronic
904246935 1:29194501-29194523 TGGTGGGAGGAAAAGGATGGCGG + Intronic
904563117 1:31412038-31412060 TTGTGTGGGCAAAAGTGCGGAGG + Intronic
908967032 1:69777847-69777869 CTGTGTGAGGAATAGAATGGGGG - Intronic
909497854 1:76299468-76299490 ATGTGTGGTTTAAAGTATGGTGG + Intronic
910762507 1:90747820-90747842 GTGTGTGTGTAAGAGGATGGGGG + Intergenic
913187798 1:116385779-116385801 TTCTGTGAGCAAAGGTGTGGCGG - Intronic
916478910 1:165197550-165197572 CAGTGTAGGTAAAAGTATGGAGG - Intergenic
918115997 1:181498133-181498155 TAGTGTGAGTCATAGTGTGGAGG + Intronic
918651299 1:186966533-186966555 TTGTGAGGATAAAAATATGGAGG + Intronic
921782433 1:219181603-219181625 TTGTGGGAGCAAAAGTGTGAGGG + Intronic
923995447 1:239489111-239489133 TTGTGTAAGAAAAAATTTGGGGG + Intronic
1064483615 10:15763446-15763468 TTGTGTGATTGAAACTCTGGTGG + Intergenic
1066481236 10:35797547-35797569 TTATCTGAGTAAAGGGATGGAGG + Intergenic
1068897079 10:62217486-62217508 TTATGTGTGTAAAAGTTAGGTGG - Intronic
1072532787 10:96335379-96335401 TTGAGTGAATGAAAGGATGGAGG - Intronic
1073588547 10:104734084-104734106 GTGTGTGAGTAGATGTATGTTGG + Intronic
1080180960 11:29425727-29425749 TAGTGTGAGAAAAAGTAAGAAGG - Intergenic
1080331546 11:31145636-31145658 TTGAATGAGGAAAAGTATGCGGG + Intronic
1081578590 11:44335233-44335255 TTGTGTGAGTGAAAGCAGGAGGG - Intergenic
1081690090 11:45072089-45072111 GTGTGTGAGTTGAATTATGGTGG + Intergenic
1082645108 11:55714214-55714236 ATGTGTGATTAAATGTAGGGAGG + Intergenic
1084663221 11:70559401-70559423 TTGTGTGAGAAAAAGAAGCGTGG - Intronic
1085788277 11:79474131-79474153 ATATGTGAGTACAAGTGTGGTGG + Intergenic
1090155557 11:124434513-124434535 TTGTGTGGGTAAAAGTCTCAGGG + Intergenic
1092064601 12:5579466-5579488 CAGTGTGAGCAAAAGCATGGTGG + Intronic
1092229261 12:6767578-6767600 TTGTGTGTGTATGTGTATGGCGG + Intronic
1092426481 12:8379531-8379553 TGGTGTGAGTAAAAGAGAGGCGG + Intergenic
1093303842 12:17487605-17487627 TTGTGTGTGTATATGAATGGGGG + Intergenic
1094216258 12:27945786-27945808 TTATGTGGGGAAAAGTTTGGGGG + Intergenic
1095690933 12:45087767-45087789 AAGTATGAGAAAAAGTATGGAGG - Intergenic
1101066065 12:101022157-101022179 TTGTGAGAGTCAATGTATGGGGG + Intronic
1104625400 12:130349468-130349490 TTTTGTGAGTCAAAGTATTGTGG + Intronic
1105209321 13:18248416-18248438 GTGTGTGAGTGTGAGTATGGGGG - Intergenic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1107194008 13:37625158-37625180 GTGGGTGAGTAAAAATATGAAGG + Intergenic
1107797898 13:44073357-44073379 TTGTTTGAGTAACAGCAAGGAGG - Intergenic
1108103417 13:46982862-46982884 AGGGGTGAGTAAAAGTATAGAGG + Intergenic
1110988271 13:82002838-82002860 TTATTTGAGTAACAGTGTGGAGG + Intergenic
1111789437 13:92835059-92835081 TTTGGTGAGTAAAAATTTGGAGG - Intronic
1112673199 13:101665856-101665878 TTGTGTGTGTAAGACTGTGGTGG - Intronic
1113706951 13:112441223-112441245 TTTTGTGAATAAACGAATGGGGG - Intergenic
1118093023 14:62503663-62503685 TTGTGTGACATAAAGTGTGGGGG + Intergenic
1118555828 14:67019977-67019999 TTGTGTGTGTACAAGTGGGGTGG + Intronic
1121680061 14:95786346-95786368 TTGTGAGTGTTAAATTATGGGGG - Intergenic
1121977124 14:98415716-98415738 TTGTGTCAGCAACAGTGTGGCGG - Intergenic
1125067847 15:35512220-35512242 TTCTGTGAGTAAATCAATGGTGG - Intronic
1125685929 15:41563212-41563234 TTGTTTGAGAAAACGTGTGGAGG - Intronic
1127130321 15:55855553-55855575 TTGTGTTAGGAAGAGGATGGAGG + Intronic
1128286644 15:66442627-66442649 TTATGTGACCAAAAGTGTGGAGG + Intronic
1128624464 15:69185694-69185716 TTCTGTGACCAAAGGTATGGGGG + Intronic
1129747368 15:78033253-78033275 GTGTGTGCGTATAAGTAAGGTGG - Intronic
1131911887 15:97214609-97214631 TTGTGTTAGAATAAGTATGTTGG + Intergenic
1134216520 16:12320888-12320910 TTGGGTGCTTAAAAGGATGGCGG + Intronic
1134340847 16:13344336-13344358 TTGTGTGTGTATAGGAATGGGGG + Intergenic
1139671494 16:68495225-68495247 ATGTCTGAGTTAAATTATGGGGG + Intergenic
1139966809 16:70750348-70750370 TTGTGTGAGAGAAAGAAGGGAGG + Intronic
1140268891 16:73445306-73445328 GTGTGTGTGTATATGTATGGGGG + Intergenic
1144100923 17:11941567-11941589 TTGTGTGGGGAAAAGAATCGTGG + Intronic
1144334684 17:14258095-14258117 TTGTGTGAAGAAAAGGAAGGTGG - Intergenic
1145099789 17:20065178-20065200 TTCTGTGACCAAATGTATGGGGG + Intronic
1145357878 17:22179742-22179764 TTATGTCAGTATAAGTCTGGTGG + Intergenic
1146269864 17:31477647-31477669 TTGTTTGAGTAAATGAATGACGG + Intronic
1146401310 17:32502050-32502072 TTCTGTGACCAAAGGTATGGAGG - Intronic
1147820203 17:43237017-43237039 TTGTATTTTTAAAAGTATGGGGG + Intergenic
1148674433 17:49437091-49437113 TCCTGTAAGTAAAAGTAGGGAGG - Intronic
1156334184 18:36153460-36153482 TTCTGTGAGCAAATGTGTGGGGG + Intronic
1158448163 18:57539298-57539320 TTGTGGGAGTCAGAGGATGGAGG - Intergenic
1161462280 19:4405083-4405105 TGGAATGAGTAAAAGTAGGGAGG - Intronic
1165981519 19:39728354-39728376 GTGTGTGAGTGAATGTAAGGGGG - Intergenic
1167736140 19:51295685-51295707 TTGTGTGTGGAAGAGTAAGGAGG + Intergenic
927578185 2:24217842-24217864 TTGTGTGAGTCTCAGTCTGGGGG + Intronic
928021106 2:27705820-27705842 TTATGTAAATAATAGTATGGTGG + Exonic
928980538 2:37131663-37131685 TTATGTGAGTGGAAGTAAGGTGG - Intronic
930687022 2:54320400-54320422 TCGTGAGAGTAAAAATAAGGTGG - Intergenic
932281495 2:70496718-70496740 TTGAGTGAGTAAATGAATGAAGG - Intronic
932672593 2:73751393-73751415 TTGGGGGAGTAATAGAATGGTGG + Intergenic
935705601 2:105854337-105854359 TTGTGTGAATGAAAGTTTTGGGG + Intronic
937666034 2:124487803-124487825 TTTTGTGGGTAAAAACATGGGGG - Intronic
939122273 2:138131823-138131845 TTCTGGGTGTAAAAGTCTGGAGG - Intergenic
940633356 2:156266080-156266102 TTGAGTGAGTAAATGAATGAAGG + Intergenic
942308700 2:174633919-174633941 TTGTGTTAGTAAAAGAAGGAAGG + Intronic
943753523 2:191535003-191535025 GTGTGGGAGGAAAAGTATGGTGG + Intergenic
944215406 2:197249448-197249470 CTGTTTGAATAAAAGTATGTTGG - Intronic
946395300 2:219441297-219441319 TTGTGTGTGTGAATGTACGGGGG + Intronic
946481660 2:220062737-220062759 TTGTTTTAGTAAAATTTTGGCGG + Intergenic
946547193 2:220757048-220757070 TGGTGTGAGCAGAAGAATGGGGG - Intergenic
947342745 2:229157049-229157071 TTGTGTGTGTATATGTATGCCGG - Intronic
948474633 2:238209241-238209263 TTATGTGAGTGCAAGTAAGGCGG + Intergenic
948647329 2:239414055-239414077 TTGTGTGAGTAAATCTAAGCAGG + Intergenic
1168986302 20:2051864-2051886 TTCTGGGAATAAAAGTATGATGG + Intergenic
1169213197 20:3778863-3778885 TTGTGAGAGTGGAAGTAGGGAGG - Intronic
1169971488 20:11273457-11273479 CTGGGTGAATAAAAATATGGAGG + Intergenic
1170565227 20:17597470-17597492 TTGTTTGTATAAATGTATGGGGG + Intronic
1170724567 20:18914835-18914857 TTCTGTGACCAAATGTATGGGGG - Intergenic
1171290482 20:23980130-23980152 GTGTGTGAGTGTGAGTATGGGGG - Intergenic
1173049700 20:39547306-39547328 TTGTGTAAGTAAAAGAAGGGGGG - Intergenic
1173321199 20:41988863-41988885 TTGCGTGAGCAAAAGCATAGGGG + Intergenic
1173597045 20:44265257-44265279 CTGTGGGAGCAAAAGCATGGAGG - Intronic
1173970014 20:47145414-47145436 GTGCAGGAGTAAAAGTATGGAGG + Intronic
1175076490 20:56379280-56379302 TTGAATAAGTAAAAGGATGGTGG + Intronic
1177055129 21:16292300-16292322 GTGGGTGAGTGAAAGTATGTAGG + Intergenic
1178388998 21:32183137-32183159 GTGTGTGAGTACAAGTGTGTGGG - Intergenic
1180766939 22:18350885-18350907 ATGTGTGAGTGTGAGTATGGGGG + Intergenic
1180812090 22:18768814-18768836 ATGTGTGAGTGTGAGTATGGGGG - Intergenic
1180861498 22:19085225-19085247 TAGTGTGAGCAAAAGTAAAGTGG + Intronic
1181198249 22:21203061-21203083 ATGTGTGAGTGTGAGTATGGGGG - Intergenic
1181401500 22:22652741-22652763 GTGTGTGAGTGTGAGTATGGGGG + Intergenic
1181410257 22:22713439-22713461 TTGTGTGAGTTAGAGAATGAAGG + Intergenic
1181703462 22:24633842-24633864 GTGTGTGAGTGTGAGTATGGGGG + Intergenic
1203228558 22_KI270731v1_random:91776-91798 ATGTGTGAGTGTGAGTATGGGGG + Intergenic
949809717 3:7993184-7993206 ATGTGTTAGGAAAAGGATGGGGG - Intergenic
952412419 3:33061548-33061570 TTTTGTAAGTAAAAGTATATTGG - Intronic
952509369 3:34038007-34038029 TTGGGTGAGTATAAGAATGGAGG + Intergenic
953586371 3:44204816-44204838 TTGTGGGGGTAAGAGTGTGGGGG + Intergenic
954891609 3:53935516-53935538 CAGTGTGAGTAAATGTATGTAGG + Intergenic
956454859 3:69410396-69410418 GTGTGTGAGTATGAGTATGAGGG + Intronic
957456057 3:80447761-80447783 TTGTGTTAGTAAAAAAATAGTGG - Intergenic
957518732 3:81291199-81291221 ATATGTGGGTAAAAGTAGGGGGG - Intergenic
960040479 3:113145232-113145254 TTGTGTGAGTCAGAGTGTGTTGG - Intergenic
960284478 3:115811576-115811598 GTGTGTGTGTAAAACTATGATGG + Intronic
960290335 3:115876782-115876804 ATGTGTGAGGAAAAATATGTTGG + Intronic
961960672 3:130851424-130851446 TTGTGTGTGTAAAAGGTAGGAGG + Intronic
962753018 3:138448501-138448523 TTGCCTTAGTGAAAGTATGGAGG + Intronic
962944733 3:140156845-140156867 TTTTGTGAGGGAAAGTAAGGAGG - Intronic
963613407 3:147502548-147502570 TAGTGTGAGCTAGAGTATGGAGG + Intronic
963789005 3:149564142-149564164 CTGTGTCAGTAAATGTAGGGTGG - Intronic
964166803 3:153717151-153717173 TGGTGTGAGTAAGTTTATGGGGG - Intergenic
964443730 3:156739084-156739106 TTGTGTGTGGACAAGTCTGGAGG - Intergenic
965065696 3:163845477-163845499 GTGTGTGAGAAAAAGCAAGGTGG - Intergenic
965103448 3:164332364-164332386 TTGTGTCAGAAAAACTAAGGTGG + Intergenic
965468779 3:169064635-169064657 TTGTGTGAGTGAAAATATGTTGG - Intergenic
965550762 3:169962748-169962770 GTGTTTGAGTAATAGTATGGAGG - Intergenic
965934859 3:174095487-174095509 GTGTGTGTGTAGAATTATGGAGG + Intronic
972588705 4:40463443-40463465 TTCTGTGGGAAAAAGTATGGTGG + Intronic
973819871 4:54653388-54653410 CTGTGTGACCAAAAGTATTGTGG - Intergenic
973901466 4:55477510-55477532 TTAGGTGACTAAAAGGATGGTGG + Intronic
976483411 4:85571154-85571176 TTATGTGAGTTAAGGTATGGAGG - Intronic
977002787 4:91524519-91524541 TTTTGTGAGTAAAAACCTGGTGG + Intronic
977949725 4:102956225-102956247 TTGTGTGTGGTAAAGTCTGGAGG - Intronic
978113450 4:104990934-104990956 TTGAGTGAATAAATGTATGATGG - Intergenic
978784390 4:112593311-112593333 TTGTGGCAGTGAAAGTATAGTGG - Intronic
979229768 4:118334692-118334714 TTGTTTGAGTACAAGTATCAGGG - Intronic
981930490 4:150184208-150184230 TTGAGTGAGTTAGAGTATTGAGG + Intronic
982107092 4:152020594-152020616 TTGAGTGAATAAATGTAAGGTGG + Intergenic
982168666 4:152639904-152639926 TTGTCTGAGTAAGACTGTGGTGG + Intronic
983395455 4:167188297-167188319 TTTTGTGAGTAAATGTATAAAGG - Intronic
984159537 4:176234328-176234350 TTGTGTAAGGAAAAGCAAGGAGG - Intronic
984967214 4:185149864-185149886 ATGTATGAGAAAAATTATGGAGG + Exonic
989120272 5:37997993-37998015 TTGAGTGTGTAAAAGGATTGAGG + Intergenic
991128068 5:63090103-63090125 GTCTGTGAGTAAAAAAATGGTGG + Intergenic
991454929 5:66792859-66792881 ATGTGTGTGTTCAAGTATGGGGG + Intronic
995364150 5:111335908-111335930 TTGTGTAATGAAAAATATGGTGG + Intronic
996393046 5:122984231-122984253 TTATGTAATTAAAAGTATGTAGG + Intronic
996633325 5:125663390-125663412 TTATGTGAGTGGAAGTAAGGTGG + Intergenic
1000875436 5:166632174-166632196 ATGTGGGAGTAAATGTGTGGAGG - Intergenic
1000930450 5:167244889-167244911 TTATGAGAGCAAAAGTATAGTGG + Intergenic
1001069382 5:168571184-168571206 TTGTGTCAGTATAAGGATTGTGG - Intronic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1003943493 6:11051593-11051615 TTGTGTGAGTGTGAGTGTGGGGG + Intergenic
1004349814 6:14881152-14881174 TTCTTTGATTAAAAGGATGGAGG + Intergenic
1005753659 6:28906335-28906357 TTGTGGGAGTAAAAATTTGTGGG - Intronic
1008313844 6:50014275-50014297 TGGTGTGAGTGAATTTATGGTGG + Intronic
1009983619 6:70756521-70756543 TTGTGTGAGTAAAAGTATGGAGG + Intronic
1012098869 6:95004311-95004333 TGTTGTCACTAAAAGTATGGAGG + Intergenic
1012549127 6:100451793-100451815 TTGTATGAGTAGAATTCTGGGGG + Intronic
1014372954 6:120636099-120636121 TAGTGTGACTAAGAGTAAGGAGG - Intergenic
1014428070 6:121333758-121333780 TTGTGGCAGTAAAAATATAGAGG + Intronic
1014818656 6:125961287-125961309 TTCTGTGACCAAATGTATGGAGG + Intronic
1017237959 6:152137088-152137110 TTGTGTGTGTGAATGTATTGAGG - Intronic
1017889476 6:158626887-158626909 GTGTGTGAGTGAAGGTGTGGGGG - Intronic
1018571112 6:165210909-165210931 TTGTATGAGTAATTCTATGGTGG - Intergenic
1019152334 6:170016843-170016865 TTGTCTCAGTAAATGTAAGGAGG + Intergenic
1022059769 7:26781856-26781878 TAGTGTGAGGAACAGTGTGGAGG - Intronic
1026298153 7:69074050-69074072 TGCTGAGAGTAAAAGAATGGAGG - Intergenic
1026654060 7:72241392-72241414 TTGTTTAAGTAAATGTGTGGGGG - Intronic
1028635872 7:92988809-92988831 CTGTGTGAATTATAGTATGGGGG + Intergenic
1032258615 7:130316562-130316584 TTATGTGAGTGGAAGTAAGGTGG + Intronic
1032613627 7:133442818-133442840 TTGTGTGACTGAAAGAATGGTGG + Intronic
1033246686 7:139722739-139722761 TTGTGAGAATGAAAGTAGGGAGG - Intronic
1034985638 7:155512455-155512477 TTGTGTGAGCAATGGAATGGGGG + Intronic
1036256488 8:7210613-7210635 TGGTGTGAGTAAAAGAAAGAGGG + Intergenic
1036308538 8:7669198-7669220 TGGTGTGAGTAAAAGAAAGAGGG + Intergenic
1036360997 8:8076879-8076901 TGGTGTGAGTAAAAGAAAGAGGG - Intergenic
1036889968 8:12590122-12590144 TGGTGTGAGTAAAAGAAAGAGGG + Intergenic
1042304884 8:67321145-67321167 TGGTGTGACTATAAGTATGGGGG + Intronic
1042720030 8:71817718-71817740 TTGTGACAGTAAAAGTTTTGTGG - Intergenic
1043107219 8:76129337-76129359 TTTTGTGAGCATAAGTAGGGTGG + Intergenic
1043500990 8:80855756-80855778 TTATTTGTGTAAATGTATGGGGG - Intronic
1043562562 8:81511308-81511330 TTGGGGGAGTAAAATTATGATGG - Intergenic
1044367648 8:91368116-91368138 TTTTGTGAGAAAAACTATAGAGG + Intronic
1045134397 8:99198549-99198571 TTCTGTGTTTAAAAGAATGGTGG + Intronic
1047199137 8:122749160-122749182 TGGTGTGAGCAAATGTATGAAGG - Intergenic
1047796973 8:128267648-128267670 ATGTGTGAGTAACAGAATGAAGG + Intergenic
1050012507 9:1199586-1199608 TGGTGTGAGTAAAAGTACAGAGG + Intergenic
1051225190 9:14891824-14891846 TTTTGTGAGAAAAAGTACAGGGG + Intronic
1051682815 9:19625189-19625211 TTGTGTGTTTAAAATTAAGGGGG - Intronic
1055210110 9:73781226-73781248 TTGGGAGAGAAAAAGTAAGGGGG + Intergenic
1056148502 9:83760019-83760041 TGCCTTGAGTAAAAGTATGGAGG - Intronic
1056804345 9:89717168-89717190 GTGTGTGAGTATATGTATGTGGG - Intergenic
1057495225 9:95555175-95555197 ATGTGTGTGAAAAGGTATGGAGG + Intergenic
1059073188 9:111161302-111161324 TTGTGTGCGTATATGTGTGGGGG - Intergenic
1059287840 9:113191711-113191733 TTGTGTGTGTGAAAGGAGGGAGG + Intronic
1059962046 9:119575121-119575143 TTTTATGAGTAAAAATATGTGGG - Intergenic
1060675010 9:125505787-125505809 TTGTGTCAGTGGGAGTATGGAGG + Intronic
1187057006 X:15750128-15750150 TTTTGTAAGTACAAGTATAGAGG - Exonic
1188195968 X:27234188-27234210 GTGTGTAAGTAAAAATTTGGGGG - Intergenic
1188323714 X:28773362-28773384 TTGTGTGATTCAAGGCATGGTGG - Intronic
1188392995 X:29644337-29644359 GTGTGTGAGGAAGAGCATGGTGG + Intronic
1189614137 X:42766908-42766930 TTATGTGAGTGGAAGTAAGGTGG - Intergenic
1190072312 X:47289510-47289532 TTATGTGAGTGGAAGTAAGGTGG + Intergenic
1190524603 X:51315935-51315957 TTGTGAAAGTACAAATATGGAGG - Intergenic
1191587408 X:62843890-62843912 TTGTGTGAGGAAATATTTGGTGG - Intergenic
1192573691 X:72226226-72226248 TTATGTGAGTGGAAGTAAGGGGG - Intronic
1194858908 X:98970244-98970266 TTGTGTGAATATAAGTAGTGGGG + Intergenic
1196229380 X:113203229-113203251 TAGAGTGAGGAAAAGTAGGGTGG - Intergenic
1197422967 X:126260972-126260994 TTCTGTGAGGACAGGTATGGTGG + Intergenic
1197827918 X:130610606-130610628 TTGAGTGAGTAAATGAATGAAGG + Intergenic
1199023836 X:142913934-142913956 TTGTGTGACTCAATGTATTGTGG + Intergenic
1201797217 Y:17910229-17910251 TGGTGTGTTTAAAATTATGGTGG - Intergenic
1201804336 Y:17995756-17995778 TGGTGTGTTTAAAATTATGGTGG + Intergenic
1202253060 Y:22892948-22892970 CTGTGTGAGTCCAAGTATGAGGG + Intergenic
1202358589 Y:24079260-24079282 TGGTGTGTTTAAAATTATGGTGG - Intergenic
1202406050 Y:24526697-24526719 CTGTGTGAGTCCAAGTATGAGGG + Intergenic
1202464730 Y:25143384-25143406 CTGTGTGAGTCCAAGTATGAGGG - Intergenic
1202512189 Y:25590853-25590875 TGGTGTGTTTAAAATTATGGTGG + Intergenic