ID: 1009983861

View in Genome Browser
Species Human (GRCh38)
Location 6:70758950-70758972
Sequence CATGGAGTTACCCCATTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 67}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009983858_1009983861 24 Left 1009983858 6:70758903-70758925 CCATGCTTTCTTACTTTGGGCAG 0: 1
1: 0
2: 1
3: 23
4: 273
Right 1009983861 6:70758950-70758972 CATGGAGTTACCCCATTTGGTGG 0: 1
1: 0
2: 0
3: 7
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009983861 Original CRISPR CATGGAGTTACCCCATTTGG TGG Intronic
904040681 1:27583048-27583070 CATGGTGAAACCCCATGTGGTGG - Intronic
911798190 1:102100188-102100210 CATGGTGTTTCCCTATTTGGGGG + Intergenic
915092293 1:153434969-153434991 AATGGAGTTACCCCACCTGGAGG - Intergenic
915262184 1:154684999-154685021 CACAGACTTACCTCATTTGGGGG + Intergenic
915845788 1:159263218-159263240 CATGGACTTACCCCCTTTTAAGG + Intergenic
916147999 1:161758796-161758818 CATGAAGTTACCCCTTTTGTAGG + Intergenic
919742413 1:200988951-200988973 CCTGGAGTTACCCCTCCTGGGGG + Intronic
924361280 1:243243880-243243902 CATTGAGTTATTCCTTTTGGGGG - Intronic
1063935655 10:11075193-11075215 CATGGAGTTGCCCCACTCTGTGG + Intronic
1068642939 10:59431611-59431633 CCTGGAGTTACCCCAAGTGGTGG + Intergenic
1070364956 10:75727885-75727907 CCTGAAGTTACCCAATTTTGGGG + Intronic
1075836942 10:125462165-125462187 CCTGGAGTTGCACCATGTGGTGG + Intergenic
1101409165 12:104455203-104455225 CATGGAGTTGGCCCACATGGTGG - Intergenic
1102342154 12:112130156-112130178 CATGACGTTACCCCATGTTGTGG + Intronic
1102424635 12:112833056-112833078 CATGGTGAAACCCCATTTGGAGG - Intronic
1105541117 13:21318318-21318340 TGTGGATTTACCCCATTTTGTGG - Intergenic
1109680351 13:65744288-65744310 CCTGGAGTTGCACCATATGGTGG - Intergenic
1116905930 14:50403526-50403548 CATGGAGGAACCCCTCTTGGGGG - Intronic
1120974637 14:90237881-90237903 CATGTTGTTCCCCCATTAGGTGG - Intergenic
1123574520 15:21653938-21653960 AATGGAGTAACCCCACTTGTGGG + Intergenic
1123611134 15:22096434-22096456 AATGGAGTAACCCCACTTGTGGG + Intergenic
1127270698 15:57398852-57398874 CATGGATTTAATGCATTTGGAGG - Intronic
1131822180 15:96284565-96284587 CATGGAGTGACCCCATGCAGGGG + Intergenic
1202983383 15_KI270727v1_random:388190-388212 AATGGAGTAACCCCACTTGTGGG + Intergenic
1138100911 16:54251784-54251806 CAAGAAGTCACCCCATGTGGAGG + Intronic
1139965984 16:70745695-70745717 CCTGGAGATACACCTTTTGGGGG - Intronic
1143466630 17:7141243-7141265 CATGGAGATGCCCCCTTTGCCGG - Intergenic
1144361785 17:14502061-14502083 CAAGGAGTTTCCCCATCTGTGGG - Intergenic
1144667588 17:17112469-17112491 CATGGAGTTAAAGGATTTGGGGG + Intronic
1146022795 17:29293441-29293463 CCTGGAGTTACCTCAATTTGGGG - Intronic
1156394634 18:36688215-36688237 CATGCAGTCACCCCACCTGGTGG - Intronic
1163896997 19:20067971-20067993 AAAGGAGTTGCCCCATTGGGTGG - Intergenic
934610767 2:95733693-95733715 CAGGGAATTACTCTATTTGGGGG - Intergenic
938135564 2:128753685-128753707 CTTGTAGTCACCACATTTGGGGG + Intergenic
938953586 2:136278999-136279021 AATGGAGTTACCCCAGCTGCAGG - Intergenic
942892790 2:181012755-181012777 TATGGTGTTAAACCATTTGGTGG + Intronic
944510039 2:200455713-200455735 TATGGAGTTACCAGATATGGAGG - Intronic
945034539 2:205693323-205693345 AATGGAGATGCCCCATTTAGAGG + Intronic
945837713 2:214852510-214852532 AATTGAGTTACCCCATGTGATGG - Intergenic
1173225614 20:41160894-41160916 CATGGGACTAGCCCATTTGGAGG + Intronic
1178617687 21:34147731-34147753 CATGGGGTTACTCAATTAGGAGG - Intergenic
1182782641 22:32880457-32880479 CATGGAGTTGTCCCACTTTGAGG + Intronic
952782589 3:37117200-37117222 CATGAACTTACCTTATTTGGAGG - Intronic
956102607 3:65784253-65784275 CATGGAGTTACCACATTCCTAGG + Intronic
959082181 3:101813498-101813520 CATGGCGTGACACCCTTTGGAGG + Intronic
962089813 3:132231153-132231175 AATGAAGTTACCCAATGTGGGGG + Intronic
973777563 4:54257218-54257240 CAGGAAGTTACCCTATATGGTGG + Intronic
989611129 5:43292807-43292829 CTTTAAGTTAACCCATTTGGAGG - Intronic
990656259 5:57959711-57959733 CATAGAGTAACAACATTTGGAGG + Intergenic
994142037 5:96352568-96352590 AATGGTGTTACCCCTGTTGGTGG - Intergenic
994509396 5:100684618-100684640 CATGGAGTTGCTCCTTTAGGAGG + Intergenic
996847288 5:127913860-127913882 CCTTGACTTACCCCATGTGGAGG + Intergenic
998028957 5:138847236-138847258 CATGGATTTTCACCTTTTGGAGG + Intronic
1003410484 6:5857814-5857836 TGTGGATTTACCCCATTTTGTGG + Intergenic
1007776011 6:44224751-44224773 CAGGGAGGTACTCAATTTGGTGG + Intronic
1008766232 6:54918858-54918880 CGGGGAGTTACACCATTTGAGGG - Intronic
1009983861 6:70758950-70758972 CATGGAGTTACCCCATTTGGTGG + Intronic
1014476242 6:121875316-121875338 AATGGAGTTCCCCCTTTTGGGGG + Intergenic
1029654833 7:101917452-101917474 CATGGAGTACCCACATTTAGGGG - Intronic
1033286509 7:140045843-140045865 CTTGTAGTTTGCCCATTTGGAGG + Intronic
1034162833 7:149005485-149005507 CCTGGATTTACCTCAATTGGAGG + Intronic
1038422871 8:27444601-27444623 CATGGAGCTACTCCATTTGTTGG - Intronic
1038936760 8:32260423-32260445 TATGGACTGACCCCATGTGGAGG - Intronic
1040884315 8:52243244-52243266 CATGGAGTTATAGAATTTGGGGG + Intronic
1041506442 8:58603713-58603735 CATGGAGACAGCACATTTGGAGG - Intronic
1044609107 8:94074499-94074521 CATGGAGTTTGCCCAGTTTGGGG + Intergenic
1049119355 8:140720551-140720573 TAGGGAGGTACCCCATTTTGTGG - Intronic
1050185382 9:2967469-2967491 CATTGACTTACTCCATTTGCTGG + Intergenic
1051263608 9:15289545-15289567 CATGGAGTTCTGCCATTTGCCGG - Intronic
1057200127 9:93135243-93135265 CATGGGATGACCCCGTTTGGAGG - Intergenic
1189953592 X:46256800-46256822 CAGGGAGTTACCTAATTTTGAGG - Intergenic
1190369815 X:49729938-49729960 CATGAAGTCACCCCTTCTGGAGG + Intergenic
1194221617 X:91200338-91200360 CATGGAGTTGGGCCACTTGGTGG - Intergenic
1200558131 Y:4664094-4664116 CATGGAGTTGGGCCACTTGGTGG - Intergenic
1201328613 Y:12794725-12794747 CATGGTCTTACCCCATTGAGTGG + Intronic