ID: 1009988155

View in Genome Browser
Species Human (GRCh38)
Location 6:70806476-70806498
Sequence GAGGGTGAGCTGAAGGAGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3059
Summary {0: 3, 1: 166, 2: 451, 3: 822, 4: 1617}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009988155_1009988168 24 Left 1009988155 6:70806476-70806498 CCGCCCTCCTTCAGCTCACCCTC 0: 3
1: 166
2: 451
3: 822
4: 1617
Right 1009988168 6:70806523-70806545 CAGTCCCAGTGAGATGAACCAGG 0: 320
1: 800
2: 1270
3: 925
4: 1105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009988155 Original CRISPR GAGGGTGAGCTGAAGGAGGG CGG (reversed) Intronic
Too many off-targets to display for this crispr