ID: 1009988155 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:70806476-70806498 |
| Sequence | GAGGGTGAGCTGAAGGAGGG CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 3059 | |||
| Summary | {0: 3, 1: 166, 2: 451, 3: 822, 4: 1617} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1009988155_1009988168 | 24 | Left | 1009988155 | 6:70806476-70806498 | CCGCCCTCCTTCAGCTCACCCTC | 0: 3 1: 166 2: 451 3: 822 4: 1617 |
||
| Right | 1009988168 | 6:70806523-70806545 | CAGTCCCAGTGAGATGAACCAGG | 0: 320 1: 800 2: 1270 3: 925 4: 1105 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1009988155 | Original CRISPR | GAGGGTGAGCTGAAGGAGGG CGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||