ID: 1009988168

View in Genome Browser
Species Human (GRCh38)
Location 6:70806523-70806545
Sequence CAGTCCCAGTGAGATGAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4420
Summary {0: 320, 1: 800, 2: 1270, 3: 925, 4: 1105}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009988156_1009988168 21 Left 1009988156 6:70806479-70806501 CCCTCCTTCAGCTCACCCTCCGT 0: 3
1: 51
2: 337
3: 769
4: 1711
Right 1009988168 6:70806523-70806545 CAGTCCCAGTGAGATGAACCAGG 0: 320
1: 800
2: 1270
3: 925
4: 1105
1009988153_1009988168 26 Left 1009988153 6:70806474-70806496 CCCCGCCCTCCTTCAGCTCACCC 0: 1
1: 44
2: 363
3: 1173
4: 3161
Right 1009988168 6:70806523-70806545 CAGTCCCAGTGAGATGAACCAGG 0: 320
1: 800
2: 1270
3: 925
4: 1105
1009988155_1009988168 24 Left 1009988155 6:70806476-70806498 CCGCCCTCCTTCAGCTCACCCTC 0: 3
1: 166
2: 451
3: 822
4: 1617
Right 1009988168 6:70806523-70806545 CAGTCCCAGTGAGATGAACCAGG 0: 320
1: 800
2: 1270
3: 925
4: 1105
1009988160_1009988168 17 Left 1009988160 6:70806483-70806505 CCTTCAGCTCACCCTCCGTGGGC 0: 3
1: 4
2: 14
3: 18
4: 185
Right 1009988168 6:70806523-70806545 CAGTCCCAGTGAGATGAACCAGG 0: 320
1: 800
2: 1270
3: 925
4: 1105
1009988157_1009988168 20 Left 1009988157 6:70806480-70806502 CCTCCTTCAGCTCACCCTCCGTG 0: 3
1: 50
2: 340
3: 787
4: 1560
Right 1009988168 6:70806523-70806545 CAGTCCCAGTGAGATGAACCAGG 0: 320
1: 800
2: 1270
3: 925
4: 1105
1009988161_1009988168 6 Left 1009988161 6:70806494-70806516 CCCTCCGTGGGCTGCACCCACTA 0: 6
1: 329
2: 1193
3: 891
4: 520
Right 1009988168 6:70806523-70806545 CAGTCCCAGTGAGATGAACCAGG 0: 320
1: 800
2: 1270
3: 925
4: 1105
1009988163_1009988168 2 Left 1009988163 6:70806498-70806520 CCGTGGGCTGCACCCACTATCCA 0: 15
1: 547
2: 822
3: 683
4: 488
Right 1009988168 6:70806523-70806545 CAGTCCCAGTGAGATGAACCAGG 0: 320
1: 800
2: 1270
3: 925
4: 1105
1009988154_1009988168 25 Left 1009988154 6:70806475-70806497 CCCGCCCTCCTTCAGCTCACCCT 0: 1
1: 108
2: 314
3: 711
4: 1460
Right 1009988168 6:70806523-70806545 CAGTCCCAGTGAGATGAACCAGG 0: 320
1: 800
2: 1270
3: 925
4: 1105
1009988164_1009988168 -10 Left 1009988164 6:70806510-70806532 CCCACTATCCAACCAGTCCCAGT 0: 8
1: 300
2: 882
3: 1158
4: 1046
Right 1009988168 6:70806523-70806545 CAGTCCCAGTGAGATGAACCAGG 0: 320
1: 800
2: 1270
3: 925
4: 1105
1009988162_1009988168 5 Left 1009988162 6:70806495-70806517 CCTCCGTGGGCTGCACCCACTAT 0: 6
1: 311
2: 1136
3: 894
4: 538
Right 1009988168 6:70806523-70806545 CAGTCCCAGTGAGATGAACCAGG 0: 320
1: 800
2: 1270
3: 925
4: 1105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009988168 Original CRISPR CAGTCCCAGTGAGATGAACC AGG Intronic
Too many off-targets to display for this crispr