ID: 1009989839

View in Genome Browser
Species Human (GRCh38)
Location 6:70828656-70828678
Sequence TTCTATTTCCACAATGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 273}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009989839_1009989841 25 Left 1009989839 6:70828656-70828678 CCTTCCACATTGTGGAAATAGAA 0: 1
1: 0
2: 0
3: 21
4: 273
Right 1009989841 6:70828704-70828726 TTCCTTACATGTAGAACTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009989839 Original CRISPR TTCTATTTCCACAATGTGGA AGG (reversed) Intronic
903735238 1:25525873-25525895 TTCTACTTCCCCAATGTCCATGG + Intergenic
906073439 1:43034570-43034592 TCCTACTTTCACTATGTGGAAGG - Intergenic
906658956 1:47568982-47569004 CAGTATTTCCACCATGTGGATGG - Intergenic
906789221 1:48644052-48644074 TTCTATTCCTGCAATGTAGAAGG - Intronic
907064773 1:51470102-51470124 GTCTATTACCACAGTATGGATGG + Intronic
909754851 1:79212394-79212416 TTATATTTTAACAAAGTGGATGG + Intergenic
910034330 1:82772450-82772472 TGCTCTTTGTACAATGTGGATGG - Intergenic
911280316 1:95918304-95918326 TTGTATTTTCACAATTTAGATGG + Intergenic
911505442 1:98744128-98744150 TACTATTTCCAGAATCTGGGAGG + Intronic
914707537 1:150182864-150182886 TTCTATTTTTACATTTTGGAAGG - Intergenic
919549528 1:198966732-198966754 GTCTGTTTCCACCAGGTGGAGGG + Intergenic
919997359 1:202765274-202765296 TTCTATACCCTCAATGAGGAAGG - Intronic
921093703 1:211868441-211868463 TTTTTCTTCCACCATGTGGAAGG + Intergenic
921497852 1:215862673-215862695 TTCTATTTCTAAAATGTGCATGG - Intronic
922306828 1:224351924-224351946 GTCCACTTCCACAGTGTGGAAGG - Intergenic
923467102 1:234258872-234258894 TTTTATTTCCACTAGTTGGATGG - Intronic
923768901 1:236920051-236920073 TACTATATTCACAATGTGGGTGG - Intergenic
923841403 1:237675441-237675463 TTTTAATTCAACAATGTGGGAGG - Intronic
924238875 1:242022387-242022409 TTGTAATTCCAGAATTTGGAAGG - Intergenic
1063640648 10:7827291-7827313 CTCCATTTCCCCAATGTGGTAGG - Intronic
1064380178 10:14834869-14834891 TGCTATTTTGACAATGCGGAGGG + Intronic
1064683392 10:17834362-17834384 TACTCTTTCCACAATGTGTTTGG + Intronic
1065123412 10:22550119-22550141 TGCTAGTCCCACAATGTGTAAGG + Intronic
1065711044 10:28518397-28518419 TTCTAGTTCCTGAAGGTGGAAGG + Intergenic
1065719146 10:28608702-28608724 TTCTATATACATAATGTGTATGG + Intronic
1066409603 10:35154054-35154076 TTCTAAGTGCACAATGTGTAAGG + Intronic
1071356844 10:84805506-84805528 TTTTATTTTCACAATGGGGCAGG + Intergenic
1072329541 10:94333734-94333756 TTTTATTTCAATACTGTGGATGG - Exonic
1074243183 10:111659734-111659756 TTCTATTTCCATAACTAGGAGGG + Intergenic
1074990952 10:118707208-118707230 TTTTATTTCTGCTATGTGGAAGG - Intronic
1076542247 10:131221459-131221481 TTCTAATTGCTCAAGGTGGAGGG - Intronic
1077735416 11:4785674-4785696 TTCTATTTGCAGAATTTGAAAGG - Intronic
1078093623 11:8283322-8283344 TTGTGTTTCCGCAATGTGCACGG - Intergenic
1078453117 11:11454971-11454993 TTCAATGTCAACAATGAGGAAGG - Intronic
1079491922 11:20998466-20998488 TTTTTTTTCCACAGTGAGGATGG + Intronic
1079630648 11:22670066-22670088 TTCTCTTTCCAGATTTTGGAAGG + Intronic
1079948937 11:26777920-26777942 TTTTATTTCCAAAAGTTGGATGG + Intergenic
1080199042 11:29647112-29647134 TTCAAATTCCACAATGTATATGG + Intergenic
1080437250 11:32256528-32256550 ATCTATTTCTACAAAATGGAGGG + Intergenic
1081953590 11:47069202-47069224 TTATATTTACACAATGGGGAAGG - Intronic
1085095901 11:73760626-73760648 CTCTAGTTCCACAATGTCCACGG - Exonic
1085706703 11:78792917-78792939 TTCTCTTTCTATGATGTGGAAGG + Intronic
1086325993 11:85700036-85700058 TTGTATCTGCACAATGTGAATGG - Intronic
1086448137 11:86889498-86889520 CTGTATTCCCACAAGGTGGAAGG + Intronic
1086726887 11:90197297-90197319 TTCTTTTTCCAGAATGGGCAAGG - Intergenic
1087721897 11:101675277-101675299 TTCTATTGCCAGAATATGGAGGG - Intronic
1087882001 11:103427652-103427674 TTGTATCTTCACACTGTGGAGGG + Intronic
1087957950 11:104313387-104313409 GTCTGTTTCCAAAACGTGGATGG + Intergenic
1090577401 11:128121189-128121211 TTCTAGTTTCATAAAGTGGAAGG - Intergenic
1093258026 12:16896583-16896605 TTCTATTTTCATAATAAGGAAGG - Intergenic
1093266652 12:17011432-17011454 GTCCCTTTCCACACTGTGGATGG + Intergenic
1093741246 12:22692572-22692594 GTCTCCTTCCACACTGTGGAAGG - Intergenic
1095287568 12:40432883-40432905 TTATTTTACTACAATGTGGAAGG - Intronic
1095321035 12:40827346-40827368 TTTCATTTCAAAAATGTGGAAGG - Intronic
1095395383 12:41756849-41756871 CTCTATTAGCACAATGTGGAGGG - Intergenic
1097212697 12:57384778-57384800 TACTTTTTCTACAATGTGAATGG + Intronic
1098062421 12:66577506-66577528 TTCTATTTCATCATTGTGTAAGG + Intronic
1098558370 12:71844896-71844918 TTTTATTTCCAGCATGTGGTTGG + Intronic
1099294361 12:80811673-80811695 TTGTATTTTCAGAGTGTGGAAGG - Exonic
1099452614 12:82825587-82825609 TATTATTTCCACAATGTGGTAGG + Intronic
1099779701 12:87177867-87177889 TTCTATTGCCATTATCTGGATGG + Intergenic
1101369175 12:104109208-104109230 TTCTCTTTCCATATTGGGGAAGG + Intergenic
1103215472 12:119198420-119198442 TTCTCTTCCCATAATTTGGATGG - Intronic
1104192936 12:126500780-126500802 TTCTTTTTCCCCTATCTGGATGG - Intergenic
1105254431 13:18732606-18732628 TTCTTCTTCCACAGTGTGGCTGG - Intergenic
1105665662 13:22553006-22553028 GTCTCCTTCCACATTGTGGAAGG - Intergenic
1105792989 13:23821043-23821065 TTCTTTTTCCACAGTGAAGAGGG + Intronic
1106773045 13:32981280-32981302 TTCTATTTCCTTACTCTGGATGG - Intergenic
1107327342 13:39258799-39258821 TTCCATTTGCACAATGTGGGTGG - Intergenic
1108075427 13:46674430-46674452 TTGTATTTCCACATTGTTGCAGG + Intronic
1108398256 13:50011267-50011289 ATCAATTTTCACAATGTGGTGGG - Intronic
1109866473 13:68271512-68271534 TTTTGTTTCCACCATCTGGAGGG + Intergenic
1110809146 13:79791994-79792016 CTCTCTTTCCCCCATGTGGAAGG + Intergenic
1111146583 13:84189861-84189883 TTCTATTTCCATAAAATGTAAGG - Intergenic
1113730826 13:112640247-112640269 TTTTATTTTGATAATGTGGATGG - Intergenic
1113839804 13:113352719-113352741 TTCTGTCTCCACAATGGAGATGG - Intronic
1116775333 14:49173824-49173846 TTCTCTTTCCCCCAAGTGGAAGG - Intergenic
1116994505 14:51308495-51308517 TTCAATTTCTAAAATCTGGAAGG + Intergenic
1118722336 14:68603342-68603364 AGCTATTTCCACAATCAGGAAGG + Intronic
1122466989 14:101940503-101940525 TTCTCTATCCAGAATGTGCATGG - Intergenic
1124023669 15:25945543-25945565 TTCTATATCCCCAAGGTGGTGGG + Intergenic
1126481194 15:49122041-49122063 TTCTACTCCCACAACTTGGAAGG + Intronic
1130197608 15:81795374-81795396 TTCCATTTCTAAAATGTGGGTGG - Intergenic
1130515444 15:84622634-84622656 TTCTATTTCCAGAAAGTGTCAGG + Exonic
1130714431 15:86317542-86317564 TTTTATTTCCTCATTGTGCATGG - Intronic
1130951447 15:88593392-88593414 TTCTATTCCTACATTGTTGAGGG + Intergenic
1135727418 16:24867687-24867709 TTTAATTTCCATAATGTTGATGG - Intronic
1136191614 16:28618861-28618883 TTCTATTTGCAAAATAAGGATGG - Intronic
1137604549 16:49778811-49778833 TGCTATTGACACCATGTGGAGGG - Intronic
1139176056 16:64689062-64689084 CTCCATTTCCACAATGTTGGAGG + Intergenic
1139281739 16:65776556-65776578 CTCTACCTCCAAAATGTGGAAGG + Intergenic
1140381917 16:74496811-74496833 TTTAACTTCCACAATGTGGTTGG - Intronic
1140865540 16:79057868-79057890 TTCCATATCCATAATGTGCAAGG + Intronic
1141452332 16:84113447-84113469 TTCTATTTCTATAATTTGAACGG - Intronic
1143283521 17:5772229-5772251 GTCCCTTTCCACACTGTGGAAGG + Intronic
1143311472 17:5994064-5994086 TTCTATTCCTAGATTGTGGATGG + Intronic
1152122953 17:78429836-78429858 CTCTACTTCCACAGGGTGGAAGG - Intronic
1158737909 18:60104768-60104790 TTCTATATCCACTATGTAAACGG - Intergenic
1160127243 18:76187168-76187190 TTCTAATTCCAGAAAGTGGCTGG + Intergenic
1161429242 19:4221798-4221820 TCCTATGTCCACAGTGTGCAAGG - Intronic
1161591691 19:5131890-5131912 TTCAATTTGGAAAATGTGGACGG - Exonic
1162742056 19:12779002-12779024 TCCTTCTTCCAAAATGTGGAGGG - Intronic
1164048281 19:21561843-21561865 TTATAATTCCAGAATGTGGGAGG + Intergenic
1164227073 19:23255361-23255383 TTTTATTTCCACAATGGTGTTGG - Intergenic
1165838968 19:38775572-38775594 TTCTATTTCTTCACTGTGGCTGG + Intergenic
1168154965 19:54468511-54468533 TTTTATTTCCATTATGGGGAAGG - Intronic
927672022 2:25076565-25076587 TTCTATTTCCCCAAAATGGTTGG + Intronic
928016991 2:27666659-27666681 TTTTTTTTCCACAATGTGGTAGG + Intronic
930920412 2:56746687-56746709 TGCCATTTCCACAATGAAGAAGG - Intergenic
931416979 2:62090787-62090809 TTCTGTTTTCACAATCTGAAAGG + Intronic
931752426 2:65341611-65341633 TACTATTTCCACATTGTAGTGGG - Intronic
932983382 2:76697882-76697904 TTTCCCTTCCACAATGTGGAAGG - Intergenic
933429526 2:82157766-82157788 TTGGATTTCCACAAAGTGAAAGG + Intergenic
935802236 2:106709493-106709515 TTTTATCTCCACATTGTAGATGG + Intergenic
937566789 2:123302340-123302362 TTCTTCTTTCACAATATGGATGG - Intergenic
940061035 2:149568441-149568463 TTTTATTTTCATAATTTGGAGGG - Intergenic
940683903 2:156822018-156822040 TACTTTTTCCAAAATGTTGAGGG - Intergenic
940888326 2:159010652-159010674 TCCTATTTCAAGGATGTGGACGG + Intronic
943046630 2:182867828-182867850 TTCTAATTCCACTAGGTGGGGGG - Intergenic
944997445 2:205309988-205310010 ATATATATACACAATGTGGAAGG + Intronic
945127511 2:206529046-206529068 TTGTATTTCCACATTGTATAGGG + Intronic
946000807 2:216480702-216480724 CTCTACTTCACCAATGTGGAGGG + Intronic
1169560007 20:6789693-6789715 TTCTCTTTCTACCATGTCGATGG - Intergenic
1169615327 20:7437155-7437177 TTCTATATCCAAAAGGTGAAGGG - Intergenic
1171445736 20:25203387-25203409 TTAGATTTCCATAATGTGCATGG + Intronic
1173095902 20:40027939-40027961 GTCTTTTGCAACAATGTGGATGG - Intergenic
1173117918 20:40263542-40263564 TTCTCTTTCCACAACCTGGTGGG + Intergenic
1173195824 20:40911988-40912010 GTCTTCTTCCACACTGTGGAAGG + Intergenic
1173370209 20:42428276-42428298 TTCTATAACCTCAATGTTGATGG - Intronic
1174718740 20:52788336-52788358 TTCCATTCCCTAAATGTGGAGGG + Intergenic
1174829660 20:53800939-53800961 ATCTATTTGCAGAATCTGGAGGG + Intergenic
1176840445 21:13837639-13837661 TTCTTCTTCCACAGTGTGGCTGG - Intergenic
1178485689 21:33018993-33019015 ATCTGTTTCCACTGTGTGGATGG - Intergenic
949311931 3:2709615-2709637 TTTAAATTCCACAATGTGGCTGG + Intronic
949977659 3:9475731-9475753 TGCTGTTTCCAGAATGTGGCTGG - Exonic
950975093 3:17232680-17232702 CTCTATTGCCACAATGTGGTGGG + Intronic
951287176 3:20827334-20827356 CTCTTTTTCCACAATCTGGGGGG - Intergenic
951592007 3:24276624-24276646 TATTATTACCACAATGTGCAAGG + Intronic
952648436 3:35691834-35691856 TTCTTTTTTCACAATGTGCTTGG + Intronic
953126983 3:40100481-40100503 CTCTATTTCAACAATATGGGTGG + Intronic
953576663 3:44118075-44118097 TACTGTTTGCAGAATGTGGAAGG + Intergenic
955095537 3:55794020-55794042 TTTTATTTCCATATTGTGAAAGG - Intronic
958019106 3:87977094-87977116 TTCTAATTCTACAATATGTAAGG - Intergenic
958159045 3:89792619-89792641 TCTTATTTCCAAAATGTGGTTGG + Intergenic
959204913 3:103294449-103294471 TTATATTACTACAATGTGAAGGG - Intergenic
959258611 3:104047543-104047565 TTATATTTACAAAATGTAGAAGG - Intergenic
959286738 3:104423833-104423855 TTCTTTTTCCAAAGTGTGAATGG - Intergenic
959522136 3:107332944-107332966 TTCTATTGGCACAATATGAATGG + Intergenic
959995829 3:112679366-112679388 TTGTATCCCCACAAGGTGGAAGG + Intergenic
963120368 3:141771285-141771307 GTCTTTTTCATCAATGTGGATGG + Intergenic
963357513 3:144228342-144228364 ATCATTTGCCACAATGTGGATGG + Intergenic
964610861 3:158613537-158613559 TTCTATCTTCACATAGTGGAAGG + Intergenic
965002581 3:162974186-162974208 TCCTCTTACCTCAATGTGGATGG - Intergenic
965770405 3:172175863-172175885 TTTTGTTTGCACTATGTGGATGG + Intronic
966430817 3:179830131-179830153 TACTATTTCCACAAAGTAAAAGG - Intronic
969148216 4:5142859-5142881 TTGATTCTCCACAATGTGGATGG + Intronic
970209631 4:13695919-13695941 TTCCATTTCCTTTATGTGGATGG - Intergenic
970895254 4:21094961-21094983 TTCTATTTCTACCATGGAGAAGG - Intronic
971713361 4:30145815-30145837 CTCTATTTTCACATAGTGGAAGG + Intergenic
973614028 4:52661262-52661284 TTCAATTTCCATTATGTCGATGG - Intergenic
973717036 4:53687216-53687238 TTCTATTTCTAAAAGGTGAAAGG - Intronic
973762321 4:54129662-54129684 TTCTATTTCCAGTTTTTGGAGGG + Intronic
974594070 4:63994725-63994747 TTCTGTTTTCACAATCTGCAAGG + Intergenic
975250772 4:72175548-72175570 TTCTGTTTTCACAATCTGAAAGG - Intergenic
976211013 4:82669720-82669742 TTGTATTTCCACCAGGAGGAGGG + Intronic
976668654 4:87627586-87627608 ATCGCTTTCCATAATGTGGATGG + Intergenic
977241009 4:94569132-94569154 TTCTAACTCCTCACTGTGGAGGG - Intronic
977647442 4:99429568-99429590 TTCTATTTCCTCAATGGAGAAGG + Exonic
979042877 4:115820591-115820613 TTCTATTTTTCCAATTTGGATGG + Intergenic
979504266 4:121478055-121478077 TCCTTTTTCTACACTGTGGAAGG + Intergenic
979609150 4:122671046-122671068 GTGTCTTTCCACACTGTGGAAGG + Intergenic
979834401 4:125345123-125345145 TTCCATTTACACATTGTAGATGG + Intronic
980490538 4:133521083-133521105 TTTTAGTTTCACAATATGGATGG - Intergenic
980558091 4:134435331-134435353 GTCTTTTGCTACAATGTGGATGG + Intergenic
982764232 4:159325529-159325551 TTGTAATTCCACTATGTAGAAGG - Intronic
982874483 4:160628387-160628409 TTCTATTTGCACAATATGGGTGG - Intergenic
983862770 4:172728424-172728446 GTCTTTTTCAGCAATGTGGATGG - Intronic
984443236 4:179799958-179799980 TTCGTTTTCCTCCATGTGGATGG - Intergenic
984456473 4:179975644-179975666 TGCTTATTCCAAAATGTGGAAGG - Intergenic
984805206 4:183745845-183745867 GTCCCTTTCCACACTGTGGAAGG - Intergenic
986495476 5:8337649-8337671 TTTTATTTCCACTATGTGCCAGG - Intergenic
987198663 5:15552679-15552701 TTCATTTTCCACACTGTGGCAGG + Intronic
988072640 5:26313860-26313882 TTCTACTTCTGCAATTTGGAGGG + Intergenic
989416091 5:41178174-41178196 ATCTATTTCAACAATGTGTGAGG + Intronic
989883616 5:46834958-46834980 TTCTTTTTCCACCATGGGCAAGG - Intergenic
989886960 5:46900578-46900600 TTCTTTTTCCACCATGGGCAAGG - Intergenic
989888257 5:46926148-46926170 TTCTTTTTCCACCATGGGAAAGG - Intergenic
989888465 5:46930240-46930262 TTCTTTTTCCACCATGGGCAAGG - Intergenic
990765825 5:59181438-59181460 TTATATTTCAAAAATGTTGATGG - Intronic
991180096 5:63740533-63740555 TGCTCTTTCCATAGTGTGGAAGG - Intergenic
994437904 5:99762386-99762408 CTCTATTTCCTCAATTTGAATGG + Intergenic
994535951 5:101029641-101029663 GTCTTTTTCCACAACATGGATGG + Intergenic
995203718 5:109455427-109455449 TTCAGTTTCCACAATTTGTATGG + Intergenic
995401624 5:111748616-111748638 TTCTCTTTCTACAAAGTGAAAGG - Intronic
996501880 5:124226147-124226169 TTCTATTTCCAGTATGGAGAGGG - Intergenic
998063416 5:139137050-139137072 TTACATTTCCACAAAGTGGAAGG - Intronic
999375257 5:151081926-151081948 TTTTAATTCCAAAAAGTGGAAGG + Intronic
1000763597 5:165257058-165257080 ATCTATTAACACAATTTGGAAGG + Intergenic
1003710233 6:8581311-8581333 TTGTAATCCCACAATTTGGAAGG - Intergenic
1004882621 6:20023736-20023758 TTCCCCTTCCACACTGTGGAAGG + Intergenic
1005751396 6:28886036-28886058 TGCTTTCTCCACATTGTGGAAGG + Intergenic
1007309416 6:40933672-40933694 TTCCCTCTCCACAATGTGGTGGG + Intergenic
1009989839 6:70828656-70828678 TTCTATTTCCACAATGTGGAAGG - Intronic
1010888539 6:81274263-81274285 TGCTATTTCCATAATGTTGATGG + Intergenic
1012509757 6:99989772-99989794 TTATATTTTCAAAAAGTGGAAGG - Intronic
1012676888 6:102126137-102126159 TTCTACTCCCACAATGTTGGAGG + Intergenic
1013139497 6:107317906-107317928 TTCCCTTTCCAAAATGTCGAAGG + Intronic
1014940128 6:127428520-127428542 CACAGTTTCCACAATGTGGAAGG + Intergenic
1015000349 6:128206760-128206782 TTCTATGTCTACATTGTGGCTGG - Intronic
1016195912 6:141339796-141339818 TTCTATATCCACATTGGTGAGGG - Intergenic
1016345033 6:143104201-143104223 TTCTATTTCCACAGAATGGTTGG - Intronic
1019019147 6:168902903-168902925 CCCTCCTTCCACAATGTGGATGG + Intergenic
1019152088 6:170013864-170013886 TTGTATTTCCATTACGTGGAAGG - Intergenic
1019606214 7:1911541-1911563 TTCTGCTGCCACAATGTGGCGGG + Intronic
1021563598 7:21993726-21993748 TTCAATTTTCATAATTTGGAGGG - Intergenic
1022551922 7:31248889-31248911 TTCTATTTTTACCATTTGGATGG + Intergenic
1022713327 7:32873897-32873919 TTCTTTTTACAAAATGTGTAAGG - Intronic
1023105375 7:36758784-36758806 ATATATATCCCCAATGTGGATGG + Intergenic
1024770084 7:52712428-52712450 TTTTATTTCCCCCATGTGGAGGG + Intergenic
1024776300 7:52790589-52790611 TACTATTTCCACAAAGTTGTTGG + Intergenic
1027735702 7:81930494-81930516 TTGTATCTCCACATGGTGGAGGG - Intergenic
1027925068 7:84449885-84449907 TGCCATTTCAACAACGTGGATGG - Intronic
1028067181 7:86401254-86401276 TTCTCTTTTCACTATGTGGTTGG + Intergenic
1028102523 7:86838919-86838941 TTCAATTTCCAAAATGTAGGTGG + Exonic
1030561672 7:111094773-111094795 TTCTTTAGCCACAATGTGAAAGG + Intronic
1030799523 7:113832116-113832138 TTCTGTATCCTCAATGTTGAAGG + Intergenic
1031572704 7:123378631-123378653 TTCCATTTCCACAATAGCGATGG + Intergenic
1034391578 7:150791613-150791635 TTTTTTTTCCAGAATGAGGAAGG - Exonic
1035605132 8:925550-925572 TTGGATGTCCACATTGTGGACGG + Intergenic
1036553508 8:9836723-9836745 TTCTATTTCCACTATGTTACTGG - Intergenic
1037153890 8:15675820-15675842 TTCTTTATCCACACTGTGGATGG + Intronic
1037612554 8:20488581-20488603 TTCTCTTTTCACAAAGTGGAGGG + Intergenic
1039419201 8:37421421-37421443 TTCTAGGGCCACGATGTGGAGGG + Intergenic
1040802078 8:51352791-51352813 GTCTTTTTCAGCAATGTGGATGG + Intronic
1040929987 8:52723461-52723483 TTCTATTTCCTCAGTGTTGTAGG - Intronic
1041057666 8:54004047-54004069 TTTTATTTCCATAATGTCTAAGG - Intronic
1041600823 8:59715489-59715511 TTCATTTTCCCCAATGTGAAAGG + Intergenic
1042075114 8:64985451-64985473 TTTCATTTCCACAATGTGCATGG + Intergenic
1043159171 8:76824426-76824448 TTCTCTTACCAGAAGGTGGATGG + Intronic
1044035694 8:87300727-87300749 TTCTATTTCCAATGTTTGGAGGG + Intronic
1044807470 8:96022896-96022918 TTTGATTGTCACAATGTGGAGGG - Intergenic
1046656692 8:116902407-116902429 TTTTATTTCCAAAATATTGATGG - Intergenic
1047688631 8:127328025-127328047 CTCTATTACCACAATTTGGATGG - Intergenic
1048019879 8:130528262-130528284 CTCTAATTCCACAATGTGTTGGG + Intergenic
1049467144 8:142756798-142756820 TTCTATTTCCTGAATATGGAAGG - Intergenic
1050808369 9:9713257-9713279 TTTTATTTCAACAATATAGAAGG - Intronic
1051453932 9:17230705-17230727 TCCTGTTTCCAGTATGTGGAGGG - Intronic
1052233891 9:26188038-26188060 GTCTCTTTCCACACTGTGGTTGG - Intergenic
1052481127 9:29027829-29027851 TACTATTTCCACCTTATGGATGG - Intergenic
1053345989 9:37378639-37378661 TTCTCTCCCCACAATGTGGCTGG + Intergenic
1053464555 9:38296263-38296285 TATTGTTTCCACAATGGGGATGG - Intergenic
1056030402 9:82547451-82547473 TTCTATTTCCTCCATTTTGAAGG + Intergenic
1056290674 9:85140771-85140793 TTCTATTTATAGAAGGTGGATGG - Intergenic
1056549754 9:87642513-87642535 TTCTCCTTCCTCAGTGTGGATGG + Intronic
1058284278 9:103155875-103155897 TGCTATCTCCAGAATGTGCAGGG + Intergenic
1059533928 9:115063681-115063703 TGGTATTTCCCCAATGTGGTAGG + Intronic
1060237169 9:121872780-121872802 TTCAACTTCAACAATGTGGAGGG + Intronic
1060279683 9:122207454-122207476 CTCTATGTCCACAAAGTGGCTGG + Intronic
1061231502 9:129318516-129318538 TTGCAGTTCCACAGTGTGGAAGG + Intergenic
1185836594 X:3350358-3350380 TAATAATTCCACCATGTGGAGGG + Intergenic
1186092026 X:6060259-6060281 TGTTATTTCCATAATGAGGATGG + Intronic
1186584179 X:10853948-10853970 TTCTATTTGCATGATGTGGAAGG - Intergenic
1186820907 X:13286389-13286411 TTCTTTTTCCTGAAAGTGGAAGG + Intergenic
1187666943 X:21624031-21624053 TTCAATTTCTAAAATGTGTATGG + Intronic
1188291824 X:28398998-28399020 TTATAATTTCATAATGTGGATGG + Intergenic
1192253432 X:69433641-69433663 TTATATTCCCACCGTGTGGAAGG + Intergenic
1192816947 X:74603599-74603621 TTAAATATCCACAATGTGCAAGG - Intronic
1194082112 X:89481525-89481547 TACTATTTCAATAATGTGTATGG + Intergenic
1195448289 X:104978141-104978163 TTCCATTTCTACAATGTTTAAGG + Intronic
1195762402 X:108260986-108261008 TCCTTTTTCTCCAATGTGGAAGG - Intronic
1196006925 X:110846670-110846692 GTCTTTTCCCACAATATGGATGG + Intergenic
1196248973 X:113435616-113435638 TTCATTTGCAACAATGTGGATGG + Intergenic
1197698132 X:129572983-129573005 TTTTATTTTCACAACCTGGAAGG - Intronic
1197853233 X:130887364-130887386 TTCTTTTTCCTCAATGGGGTGGG - Intronic
1198203069 X:134441346-134441368 TTCTACTTCCACTTTGTGGGTGG - Intergenic
1198640882 X:138755237-138755259 TTTAATATCCACAATGTGCAAGG - Intronic
1198821649 X:140654497-140654519 TTATATTTCTTCAATGTTGAGGG - Intergenic
1199172463 X:144746955-144746977 TTCTCTTTTCACAATCTGAAAGG - Intergenic
1199949267 X:152693502-152693524 TTTAATCTCCATAATGTGGATGG - Intergenic
1199951444 X:152709103-152709125 TTTAACTTCCATAATGTGGATGG - Intergenic
1199958239 X:152759358-152759380 TTTAACTTCCATAATGTGGATGG + Intergenic
1199960409 X:152774947-152774969 TTTAATCTCCATAATGTGGATGG + Intergenic
1200434784 Y:3137715-3137737 TACTATTTCAATAATGTGTATGG + Intergenic
1200710490 Y:6480364-6480386 TTTTATTTCCACAGTTTTGATGG + Intergenic
1200828138 Y:7664165-7664187 TTTTATTTCCACAGTTTTGATGG + Intergenic
1200884865 Y:8257488-8257510 TTTTATTTCCACAGTTTTGATGG + Intergenic
1200953633 Y:8924368-8924390 TTTTATTTCCACAGTTTTGATGG - Intergenic
1200955469 Y:8939434-8939456 GTCCACTTCCACACTGTGGAAGG + Intergenic
1201023447 Y:9681630-9681652 TTTTATTTCCACAGTTTTGATGG - Intergenic
1201240034 Y:11949839-11949861 TAATAATTCCACCATGTGGAGGG - Intergenic
1202107822 Y:21388736-21388758 TTTTATTTCCACAGTGTTGAGGG + Intergenic
1202196339 Y:22301771-22301793 TTTTATTTCCACAGCGTTGATGG + Intergenic
1202231752 Y:22665835-22665857 TTTTATTTCCACAGTTTTGATGG - Intergenic
1202311406 Y:23530330-23530352 TTTTATTTCCACAGTTTTGATGG + Intergenic
1202559396 Y:26140264-26140286 TTTTATTTCCACAGTTTTGATGG - Intergenic