ID: 1009990420

View in Genome Browser
Species Human (GRCh38)
Location 6:70836294-70836316
Sequence CAGGCAAAGACAGCCTGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 659
Summary {0: 1, 1: 0, 2: 14, 3: 203, 4: 441}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009990420 Original CRISPR CAGGCAAAGACAGCCTGTGT AGG Intronic
900822893 1:4902964-4902986 CAGGCAAAGAGAGCTTGTGCAGG + Intergenic
900829139 1:4951671-4951693 CAGGAAAATGCAGCATGTGTTGG + Intergenic
901124815 1:6921726-6921748 CAGGCAAAGAGAGCTTGTGCAGG + Intronic
901186057 1:7374069-7374091 CTGGCAACCACAGCCTGTGGTGG + Intronic
901212512 1:7534574-7534596 CAGACAAAGACAGAGGGTGTGGG - Intronic
901803362 1:11722186-11722208 GAGGCACACACAGCATGTGTGGG - Exonic
902519840 1:17010008-17010030 CAGGCACCCACAGGCTGTGTGGG + Intronic
902779287 1:18693958-18693980 CAGGCAAAGCCATCCTGAGGGGG + Intronic
902954803 1:19918235-19918257 AAAGCAAAAACGGCCTGTGTGGG - Intergenic
903062504 1:20679617-20679639 CCTGCAAAGACAGCCAGAGTGGG - Intronic
905309806 1:37041466-37041488 GAGGCAAAGGCAGCCTGGGCAGG + Intergenic
905422538 1:37858300-37858322 AAGGCAAAGACAGGATTTGTAGG - Intronic
905496013 1:38387101-38387123 CAGGCAAAGAGAGCTTGTGCAGG + Intergenic
905900199 1:41576302-41576324 CAGGCACAGAGAGGCTGTGCAGG + Intronic
906849967 1:49237305-49237327 CAGGCAGAGAGAGCTTGTGCAGG - Intronic
907020879 1:51066049-51066071 CAGGCAAACAGAGCTTGTGGAGG + Intergenic
907021169 1:51067977-51067999 CAGGCAAAGAGAGCTTGTGCAGG + Intergenic
907964927 1:59319756-59319778 CAGGCAGAGGGAGCCTGTGGAGG + Intronic
907966106 1:59331412-59331434 AAGACAAATACAGCTTGTGTTGG - Intronic
908128544 1:61052741-61052763 CAGGCCAGGAGAGCCTGTGAAGG - Intronic
909058284 1:70848136-70848158 CAGGCAAAGAGAGCTTGTGCAGG + Intergenic
909185501 1:72481101-72481123 CAGGCAAAGAGAGCTTGTGCAGG + Intergenic
909192467 1:72572038-72572060 CAGGCAAAAAGAGCTTGTGCAGG - Intergenic
909192729 1:72573981-72574003 CAGGCAAAGAGAGCTTTTGCAGG - Intergenic
909468591 1:76001628-76001650 TAGGCAAAGAGAGCTTGTGCGGG - Intergenic
909592061 1:77361733-77361755 CAAGCAAAGAGAGCTTGTGCAGG + Intronic
909702498 1:78542882-78542904 CAGGCAAGGAGAGCTTGTGCAGG - Intergenic
910083423 1:83370899-83370921 CAGGCAAAAAGAGCTTGTGCGGG + Intergenic
910255974 1:85248125-85248147 CAGGCAAAAAGAGCTTGTGCAGG + Intergenic
910443419 1:87276202-87276224 CTGTCAGAGACAGCCTGTCTGGG - Intergenic
911135096 1:94430555-94430577 CAGACAAAAACAGCTTGTGCAGG - Intronic
911193385 1:94970048-94970070 CAGCCAAAGGCAGGCTGTGGGGG - Intergenic
911985595 1:104617835-104617857 CAAGCAATGAGAGCTTGTGTGGG + Intergenic
912384282 1:109263579-109263601 CAGGAAAAGGCAGACTGTGACGG - Intronic
912467275 1:109882753-109882775 GACGCACAGACAGCCTCTGTTGG + Intergenic
915989408 1:160498494-160498516 CAGGCAAAGAGAACATGTGCAGG + Intronic
916477261 1:165182312-165182334 CAGGCAAAAAGAGCTTGTGCAGG - Intergenic
916477535 1:165184216-165184238 CAGGCAAAGAGAGCTTGTGCAGG - Intergenic
916579060 1:166091440-166091462 CAGGCAAAAAGAGCTTGTGCAGG - Intronic
917690112 1:177460084-177460106 CAGGCAAAGAGAGTGTGTGTAGG - Intergenic
918301326 1:183206817-183206839 CCAACAGAGACAGCCTGTGTAGG + Intronic
919092784 1:192994415-192994437 CATGCAAATGCAGCGTGTGTGGG - Intergenic
919302254 1:195785592-195785614 CAGGCAAAGAGAGCAAGTGCAGG - Intergenic
919398751 1:197082431-197082453 CAGGCAAAAAGAACCTGTGCAGG - Intergenic
920009488 1:202857564-202857586 GAGGCAACCACAGCCTGTGCTGG - Intergenic
920544981 1:206808893-206808915 CAGGAAAGGACAGCCTGGGTGGG + Intronic
921246835 1:213252241-213252263 CAGGGAAAGATTGTCTGTGTAGG + Intronic
921530493 1:216276740-216276762 CAGGCAGAGAAAGCTTGTGCAGG + Intronic
922248804 1:223827360-223827382 CAAGCAAAGAAAGCGTGTGAGGG + Intronic
922530710 1:226342839-226342861 CAGGCAAAGAAAGCTTCTGCAGG - Intergenic
922565519 1:226599010-226599032 CAGGCAAAGAGAGTTTGTGCCGG + Intronic
922669391 1:227497344-227497366 CAGGCAAAAAGAGCTTGTGTAGG - Intergenic
922670202 1:227503958-227503980 CAGGCAAAAAGAGCTTGTGTAGG + Intergenic
923074473 1:230597433-230597455 GAGGCATGGGCAGCCTGTGTGGG - Intergenic
923350517 1:233100688-233100710 GAGGGAAAGACAGTGTGTGTGGG - Intronic
1063014836 10:2065388-2065410 CAGGCAAAGAGAGCTTGTGTAGG + Intergenic
1063032648 10:2251174-2251196 CAGGCAAAGAAAGTGTGTGGGGG - Intergenic
1064776990 10:18789610-18789632 CAGGCAAATAGAGCTTGTGCAGG - Intergenic
1064922345 10:20532621-20532643 CAGACAAAGACAGGTTGTGCAGG - Intergenic
1065071803 10:22032459-22032481 CAGACAAAGAGAGCTTGTGCAGG - Intergenic
1065624014 10:27612443-27612465 CTTGCAAACACAGCCTTTGTAGG - Intergenic
1066363694 10:34755865-34755887 CAGGTAAGCACAGCCTGTCTTGG - Intronic
1066641649 10:37560037-37560059 CAGGCAAAGAGGGCATGTGCAGG + Intergenic
1067287581 10:44918072-44918094 CAAGGAGAGACAGCTTGTGTGGG + Intronic
1067814561 10:49463771-49463793 CAGGCAAAGAGAGCTTATGCAGG - Intronic
1068103050 10:52580724-52580746 CAGGCAGAGAGAGCTTGTGTAGG + Intergenic
1068184073 10:53563206-53563228 CAGGTAAAGAGAGCTTGTGTAGG - Intergenic
1068184345 10:53565150-53565172 CAGGCAAAGAGAGCTTGTGCAGG - Intergenic
1068290076 10:54989979-54990001 CAGGCAAAGAGAGCTTGTGCAGG - Intronic
1068824884 10:61425144-61425166 CAGGCAAAGAGGGCTTGTGCAGG + Intronic
1069173747 10:65263787-65263809 CAGGCAAAGAGAGCTTGTGCAGG + Intergenic
1070578858 10:77703554-77703576 CAGACTAAGACAGCCAGTCTTGG + Intergenic
1071509888 10:86254866-86254888 CAGGCAAGGCCAGCCTGCTTGGG - Intronic
1072550824 10:96475921-96475943 CAGGCAAGGAGAGCTTGTGCAGG - Intronic
1073583566 10:104688336-104688358 CAGGCAGAGGCTGCGTGTGTGGG + Intronic
1073641020 10:105252739-105252761 CAGACAAAGAGAGGCTGTGGAGG - Intronic
1073656055 10:105417955-105417977 CAGGCAAAGAGAGCTTGTGCAGG - Intergenic
1074141283 10:110675229-110675251 AAGGAAAAGAGAGCCTGTTTTGG + Intronic
1074620411 10:115113599-115113621 CAGGCAGAGAGAGCTTGTGCAGG - Intronic
1074727842 10:116332058-116332080 CAGGCAAAGAGAGCCAGGGTTGG - Intronic
1074856154 10:117475194-117475216 CAGGCCACAACAGCATGTGTGGG + Intergenic
1075057757 10:119232654-119232676 CAGGCAAAGAGAGCTTGTGCAGG - Intronic
1075550214 10:123387249-123387271 TAGGCAAAGAGAGCTTGTGCAGG - Intergenic
1075565346 10:123499514-123499536 CAGGCAAAGAGAGCTTGTGCAGG - Intergenic
1079842160 11:25416859-25416881 CAGGCAAAGAGAGCTTGTGCAGG - Intergenic
1080049386 11:27843589-27843611 AAGGCAAAGACAGCCTGGATGGG - Intergenic
1080129931 11:28782127-28782149 CAGGCAGAGAGAGCTTGTGCAGG + Intergenic
1080227713 11:29978388-29978410 CAGGCAAAGAGAGCTTGTGCAGG - Intergenic
1080704550 11:34678110-34678132 CAGGCAAAGAGGGCATGTGCAGG - Intergenic
1081150179 11:39618786-39618808 CAGGCAAAGAGAGCTTGTTCAGG + Intergenic
1081821750 11:46003871-46003893 CAGGCAACCACAGCCTATTTTGG + Intronic
1083503858 11:63137091-63137113 CAGACACAGACACCCTGTGGTGG - Intronic
1085588084 11:77730772-77730794 CAGGAAAAGAAAGCTTGTGCAGG - Intronic
1085593809 11:77790259-77790281 CAGGCAAAGAGAGCTTGTGCAGG + Intronic
1085594090 11:77792156-77792178 CAGGCAGAGAGAGCTTGTGCAGG + Intronic
1087508644 11:99061305-99061327 CATGCAAAGACTGAGTGTGTGGG + Intronic
1087831291 11:102822113-102822135 CAGGCAAAGAGAGCCTGTGCAGG - Intergenic
1087831493 11:102823966-102823988 CAGGCAAAGAGAGCTTGTGCAGG - Intergenic
1087924188 11:103900404-103900426 CAGGCAAAGAGAGTTTGTGCAGG - Intergenic
1088175939 11:107052472-107052494 CAGGCAAAGAGAGCTTGTGCAGG - Intergenic
1088391245 11:109317247-109317269 CAGGCAAAGAGAGCTTGTGCAGG - Intergenic
1088668347 11:112117314-112117336 CAGGCAAAAAGAGCTTGTGCAGG + Intronic
1090099051 11:123774527-123774549 CAGGCAAAGAAAGCTTGTGCAGG + Intergenic
1090512318 11:127388406-127388428 CAGGAAAAGATAGGGTGTGTTGG - Intergenic
1091685065 12:2555659-2555681 CCCGCAAAGACTGCCTGTGAGGG - Intronic
1091976251 12:4827881-4827903 CAGGGATAGGAAGCCTGTGTGGG + Intronic
1092662802 12:10756576-10756598 CAGGCAAAAAGAGCTTGTTTAGG + Intergenic
1093076030 12:14759864-14759886 CAGGCAAAGAGAGTTTGTGCAGG - Intergenic
1093076312 12:14761815-14761837 CAGGCAAAGAGAGCTTGTGCAGG - Intergenic
1093141711 12:15517235-15517257 CAAGCAAAGAGAGCTTGTGTAGG + Intronic
1093541084 12:20286139-20286161 CAGGCAAAGAGAGCTTGTGCAGG - Intergenic
1093590312 12:20894984-20895006 CAGGCAAAGGGAGCTTGTGCAGG + Intronic
1094049745 12:26205888-26205910 GAGACAAAGCCAACCTGTGTGGG - Intronic
1094372936 12:29757806-29757828 CAGGCAAAGAGAGCTTGTGCAGG + Intronic
1095191042 12:39258428-39258450 CAGGCAAAGAGAGCTTGTGCAGG + Intergenic
1095252986 12:40000098-40000120 CAGGCAAAGAGAGCTTGTGCAGG - Intronic
1095520826 12:43063399-43063421 CAGGGAATGACAGGATGTGTAGG + Intergenic
1097148366 12:56957477-56957499 CAGACACAGACAGGCTGTGGGGG + Exonic
1097329741 12:58319694-58319716 CAGGCAAAGAGAGCTTGTGCAGG + Intergenic
1097400568 12:59123872-59123894 CAGGCAAAAAGAGCTTGTGCAGG + Intergenic
1097900870 12:64872823-64872845 CAGGCAAAGAGAACTTGTGCAGG + Intronic
1098437158 12:70480072-70480094 CAGGCAGAGAGAGCTTGTGTAGG - Intergenic
1098676232 12:73293369-73293391 CAGGCAAAGAGAGGTTGTGCAGG - Intergenic
1099249941 12:80242058-80242080 CAGCCAAAGACAACATGTTTCGG - Intronic
1099501335 12:83418002-83418024 CAGGCAAAGAGAGCTTGTGCAGG - Intergenic
1099501585 12:83419931-83419953 CAGGCAAAGAGAGCCTGTGCAGG - Intergenic
1099800434 12:87450752-87450774 CAGGCAAAGAGAGCTTATGCAGG - Intergenic
1100014425 12:89991694-89991716 GAGAAAAAGACTGCCTGTGTTGG - Intergenic
1100054515 12:90492009-90492031 CAAGCAAAGAGAGCTTGTGCAGG - Intergenic
1100222619 12:92522288-92522310 CAGGCAAAGAGGGCGTGTGTAGG - Intergenic
1100228769 12:92586244-92586266 CAGGTAAAAACAACTTGTGTAGG + Intergenic
1100353620 12:93808341-93808363 CAGGCAAGGAGAGCCTGTGCAGG + Intronic
1100793429 12:98155129-98155151 CAGACAAAGATTGCCTGGGTAGG - Intergenic
1101576839 12:106005237-106005259 CAGGCAAAGAGAGTGGGTGTGGG + Intergenic
1101642341 12:106596288-106596310 CAGGCAAAGAGAGCTTGTGCAGG - Intronic
1102758378 12:115363591-115363613 CAGGCAGGGACAGCATGTGCAGG + Intronic
1104919656 12:132283865-132283887 CAGGGAAAAGCAGCCTGTCTGGG + Intronic
1105753642 13:23444885-23444907 CAGGCAGAGAGAGCTTGTGCAGG - Intergenic
1107861743 13:44667353-44667375 CAGGGAAAAAAAGCCAGTGTAGG - Intergenic
1108778458 13:53796912-53796934 CAGGCAGAGAGAGCTTGTGCAGG + Intergenic
1108810507 13:54218347-54218369 CAGGCAAAGAGAGCTTGTGCAGG - Intergenic
1109169148 13:59074853-59074875 TAGGCAAAGAGAGCTTGTGCAGG + Intergenic
1109169397 13:59076764-59076786 TAGGCAAAGAGAGCTTGTGCAGG + Intergenic
1109433385 13:62266759-62266781 CAGGCAAAAAGAGCTTGTGCAGG - Intergenic
1110014570 13:70385604-70385626 CAGGCAAAGAGAGTTTGTGCAGG + Intergenic
1110156761 13:72326299-72326321 CAGGCAAAGAGAGCATGTCCAGG + Intergenic
1110552095 13:76821686-76821708 CAGGCAAAGAGAGCTTGTGCAGG + Intergenic
1110591794 13:77271653-77271675 CAGGCAAAGAGAGCTTGTTCAGG - Intronic
1110960212 13:81612166-81612188 CAGGCAAAAAGAGCTTGTGCAGG + Intergenic
1111375968 13:87379521-87379543 CAGGGAAAGCCAGCCTATTTTGG - Intergenic
1111385597 13:87522381-87522403 CTGGGAAAGACAGCATGTGCAGG - Intergenic
1111510489 13:89255464-89255486 CAGGCAAAGAAAGCATGTGCAGG - Intergenic
1111551581 13:89819288-89819310 CAGAGAAAGAGAGCTTGTGTAGG - Intergenic
1111986456 13:95071071-95071093 CAGGCAAAGAGAGTTTGTGCAGG - Intronic
1112301881 13:98238589-98238611 CAGGCAAAGAGAGAGTGTGCAGG + Intronic
1112514917 13:100045062-100045084 CATGAAAAGACAGCCTGTTTCGG + Intergenic
1113247658 13:108416460-108416482 CAGGCAAAGAGAGTTTGTGCAGG + Intergenic
1113682400 13:112253593-112253615 CAGGCACACACAGCCCATGTCGG + Intergenic
1113797195 13:113065468-113065490 CCGGCACAGACATCCTGTCTCGG - Intronic
1114687430 14:24547513-24547535 CAGGCAAAGAGAGCTTATGCAGG + Intergenic
1114998551 14:28391580-28391602 CAGGCAAAAAGAGCCTGTGCAGG - Intergenic
1116374098 14:44175443-44175465 CAGGCAAAGAGAGCATGAGCAGG + Intergenic
1116715435 14:48419980-48420002 CAGACAAATACACCCAGTGTTGG + Intergenic
1117054302 14:51895879-51895901 CAGGCAAAGAGAGCATGTGCAGG - Intronic
1117959960 14:61153099-61153121 GGGGCAAGAACAGCCTGTGTTGG + Intergenic
1117977595 14:61313730-61313752 CAGGTGAAGAGAGCTTGTGTAGG + Intronic
1119331215 14:73795413-73795435 CAGGAAAAAGCACCCTGTGTGGG - Intergenic
1119775490 14:77245648-77245670 CAGGCAAAGAGAGCTTGTGCAGG + Intronic
1120457909 14:84755413-84755435 CAGGCAAAGAGACCTTGTGCAGG - Intergenic
1120670141 14:87353848-87353870 CAGGCAAAGAGAGTTTGTGTAGG + Intergenic
1120956895 14:90090812-90090834 CAGGCAAAGAGAGCTTGTGAAGG - Intronic
1121278917 14:92686303-92686325 TAGCCATAGTCAGCCTGTGTGGG - Intronic
1121865045 14:97355095-97355117 CAGGGAAAGAGAGCATGTGAAGG - Intergenic
1122016820 14:98803460-98803482 CAGGCAGAGGCTGCCTGTGTTGG - Intergenic
1122126245 14:99580125-99580147 CTGGGACAGACAGCCTGTGCAGG + Intronic
1122571011 14:102700981-102701003 CAGGCAAAGAGAGCTTGTGCAGG + Intronic
1122628584 14:103097244-103097266 CAGGCTAATACACCCTTTGTGGG - Intergenic
1122924739 14:104894413-104894435 CAGGCAAAGGCAGGCTGGCTGGG - Intronic
1124046048 15:26150718-26150740 CAGGCAAAGAGAACTTGTGCAGG - Intergenic
1124252767 15:28117736-28117758 CAGGGAGTGACTGCCTGTGTTGG - Intronic
1124839942 15:33232361-33232383 AAGGAAAAGAAAGCTTGTGTTGG + Intergenic
1125100122 15:35902713-35902735 GAGGCAAAGACAGCTTGTACAGG - Intergenic
1125189991 15:36980470-36980492 CAAGCAAAGAGAGCTTGTGCAGG + Intronic
1125273839 15:37970288-37970310 CAAGAGAAGACAGCTTGTGTAGG + Intergenic
1125837089 15:42762019-42762041 CAGGCAAAGAGAGCTTGTGCAGG - Intronic
1126329572 15:47517621-47517643 CAGGTAAAGATTTCCTGTGTGGG - Intronic
1126490899 15:49234559-49234581 CGGGCAAAGAGAGCATGTGCAGG + Intronic
1126791172 15:52222586-52222608 CAGGCAGAGTCAGCCAGTGGTGG + Intronic
1127037371 15:54933025-54933047 CAGACAAAGCCAGTCTGTGAAGG - Intergenic
1127853768 15:62938278-62938300 CAGGCAAAGATAGCGTGTGCAGG + Intergenic
1128507452 15:68284877-68284899 CAGGCAAAGTGAGCTTGTGCAGG - Intronic
1128618650 15:69130410-69130432 CAGGCAAAGACAGCCCTCGATGG + Intergenic
1129266593 15:74396673-74396695 AAGGCAACGTCAGCCTGAGTGGG + Intergenic
1130917986 15:88321024-88321046 TGGGCAAAGGCAGCCTGTGATGG - Intergenic
1131111898 15:89769754-89769776 AAGGCAAATAAAGGCTGTGTGGG + Intronic
1131767794 15:95699783-95699805 CAGGCAAAGAGAGCTTGTGCTGG + Intergenic
1131768059 15:95701721-95701743 CAGGCAATGAGAGCTTGTGCAGG + Intergenic
1131979423 15:97980626-97980648 CAGGCATCGTCAGCCTGTGGAGG + Intergenic
1132140123 15:99385290-99385312 CAGGGAAAGGCGGACTGTGTTGG + Intronic
1132237051 15:100229936-100229958 CAGGGAAAGCCTGCCTGTGTTGG + Intronic
1132419912 15:101656194-101656216 TAGACAAAGACAGCATTTGTTGG - Intronic
1133601848 16:7347357-7347379 CAGGCAAAGAGAGCTCGTGCAGG + Intronic
1134090665 16:11390175-11390197 CAGCCCAAGACAGCATCTGTTGG + Exonic
1134373888 16:13651952-13651974 CAGGCAAAGAGAGAATGTGTAGG + Intergenic
1134569114 16:15276408-15276430 CAGGCAAAAAGAGCTTGTGCAGG + Intergenic
1134733263 16:16479637-16479659 CAGGCAAAAAGAGCTTGTGCAGG - Intergenic
1134934175 16:18232336-18232358 CAGGCAAAAAGAGCTTGTGCAGG + Intergenic
1135181412 16:20277765-20277787 CAGGCAAAGAGAGCTTGTGCAGG + Intergenic
1136122944 16:28152142-28152164 CAGGCAAAGACTGCTTGTGAAGG + Intronic
1136342924 16:29656728-29656750 CAGGCAAAGCCATCCTGAGAAGG + Intergenic
1137960621 16:52878362-52878384 CAGGGAAAGACAGCTTTTGTAGG - Intergenic
1138908979 16:61373750-61373772 CAGGCAAAGAGAGCTTGTTCAGG - Intergenic
1139175669 16:64684348-64684370 CAGGCAAAGAAAAGCTGTGTAGG + Intergenic
1140425506 16:74857861-74857883 AAGGCTAAGGCAGCCAGTGTGGG - Intergenic
1141410969 16:83832927-83832949 CAGGCAAAGAGAGCTTGTGCAGG + Intergenic
1141659155 16:85432390-85432412 CAGGCAACGAGAGACTGGGTGGG + Intergenic
1141835737 16:86538122-86538144 AAGGCAAGGCCAGCCTGAGTGGG - Intronic
1143522919 17:7455743-7455765 AACGCAAAGACAGCCAGTGCCGG - Intronic
1144255614 17:13464179-13464201 CAGGCAAAGAGAGTTTGTGCAGG - Intergenic
1145036228 17:19542522-19542544 AAGGCAAACACAGACAGTGTTGG - Intronic
1148384491 17:47224294-47224316 CAGGCAAAGAGAGCTTGTGCAGG + Intergenic
1148749772 17:49938828-49938850 CAGGCAGAGGAAGCCTTTGTGGG - Intergenic
1149216070 17:54356615-54356637 CAGGCAAAGAGAGCTTGTGCAGG + Intergenic
1149260581 17:54876075-54876097 CAGGCAAAGAGAGCTTGTGGAGG - Intergenic
1149308528 17:55372252-55372274 CAGGCAAAAAGAGCATGTGCAGG - Intergenic
1149732746 17:58962715-58962737 AGAGCAAAGACAGCCTGTGGAGG - Intronic
1151726200 17:75886114-75886136 CAGGCAAGGAAAGCGTGTGCAGG - Intronic
1152010048 17:77707393-77707415 CAGGCAAAAAGAGCGTGTGCAGG - Intergenic
1153530992 18:6045547-6045569 CAGGCAAAGACGGTTTGTGCAGG + Intronic
1153840501 18:9003560-9003582 CAGGCAAAGAGAGCTTGTGCAGG - Intergenic
1155881019 18:31148789-31148811 CAGGCAGAGACTGCATCTGTGGG - Intronic
1156289027 18:35729112-35729134 TAGGCAAAGAGAGCTTGTGCAGG - Intergenic
1156543318 18:37938722-37938744 CAGGCAAAGAGAGCTTGTTCAGG - Intergenic
1156583918 18:38410489-38410511 CAGGCAAAGAGAGCTTGTGCAGG - Intergenic
1156813940 18:41286180-41286202 CAGGCAAAGAGAGCTTGTGCAGG + Intergenic
1157098110 18:44705596-44705618 CAGGCAAAGACAGCTTATATGGG + Intronic
1157516706 18:48316381-48316403 CAGGCAAACACAGGCTGTGATGG + Intronic
1157960123 18:52144095-52144117 CAGGCAAAGAGAGCTTGTACGGG - Intergenic
1158597630 18:58830016-58830038 CAGGAAAAGAGAGCTTGTGCAGG + Intergenic
1158908275 18:62035105-62035127 CAGGCAAAAAAAGCATGTGCAGG - Intergenic
1159033265 18:63252599-63252621 CAGGCAAAGAGAGCTTGTGCAGG - Intronic
1159297033 18:66505069-66505091 CTTGCAAAGACTGCCTGTATAGG + Exonic
1159618023 18:70604154-70604176 CAGGCAAAGAGAGCATGTGTAGG + Intergenic
1159731758 18:72035682-72035704 CAGGCAAAGAGAGCTTGTGCAGG + Intergenic
1160173377 18:76572789-76572811 CAGGCAAACACAGCCGGTGTTGG - Intergenic
1160188259 18:76693041-76693063 CAGGCAAAGAGAGCTTGTGCAGG + Intergenic
1160388836 18:78515063-78515085 CAGGCAACCACAGCCTTTGCAGG + Intergenic
1160920074 19:1515440-1515462 CAGCCTAAGACACCCGGTGTAGG + Intergenic
1160956577 19:1695672-1695694 CAGGCAGAGAGAGCTTGTGCAGG - Intergenic
1162537079 19:11269099-11269121 CAGGCCTGGACACCCTGTGTTGG - Intergenic
1163374796 19:16923383-16923405 CAGCCAGACACAGCCTGTGAGGG + Intronic
1163853285 19:19679291-19679313 CATGCAAATGCAGCGTGTGTGGG + Exonic
1164782790 19:30906878-30906900 AGGGCAAAGACAGCCTTTGTTGG - Intergenic
1164851276 19:31486328-31486350 CAGGCAGAGAGAGCTTGTGCAGG + Intergenic
1165652556 19:37504191-37504213 GAGGGAAAGACAGCCTTTGAGGG - Intergenic
925371279 2:3347442-3347464 CAGGCAAAGAGAGCTTGTGCAGG - Intronic
925422210 2:3721818-3721840 CAGGCAAAGAGAGCTTGTGCAGG - Intronic
925590202 2:5501759-5501781 CAGGCAAAGAGAGTGTGTGCAGG - Intergenic
925760310 2:7178459-7178481 AAGGCTAAGGCAGCCAGTGTGGG + Intergenic
926261092 2:11262602-11262624 CAGGCAAAGAGAGCTTGTGCAGG - Intronic
926515335 2:13837856-13837878 CAGGCAAAGAGAGCTTGTGCAGG - Intergenic
926597580 2:14808522-14808544 TAGGCAAAGAGAGCTTGTGCAGG - Intergenic
926739866 2:16102311-16102333 CAGGCTGAGGCAGCCTGTGTTGG - Intergenic
926994048 2:18714788-18714810 CAGGCAAAGCCAGCTTATGTAGG + Intergenic
927294177 2:21434564-21434586 CAGGCAAAGAGAGAGTGTGCAGG - Intergenic
927578549 2:24220770-24220792 CAGGCAGAGACAGCATTTGGAGG + Intronic
927869941 2:26616972-26616994 CAGGCAAGCACTGCCTGTGAGGG + Intronic
928130854 2:28649053-28649075 CAGTCAAAGGCAGGCTGTGTGGG - Intergenic
928186135 2:29113017-29113039 CCCCCAAAGACAGCCTGTGTAGG + Intronic
928254468 2:29710134-29710156 CAGGCAAAGAGAGCATGTGCAGG - Intronic
928804233 2:35131660-35131682 CAGGCAAAGAGAGCTTGTGCAGG + Intergenic
929275440 2:40020353-40020375 CAGGCAAAGAGAGCTTGTGCAGG - Intergenic
929999887 2:46854131-46854153 CAGGCAAAGAGAGCTTGTGCAGG - Intronic
930333874 2:50020689-50020711 CAGGTAGAGCTAGCCTGTGTTGG + Intronic
930600003 2:53432142-53432164 CAGGCAAAGAGAGTTTGTGCAGG + Intergenic
930729906 2:54718921-54718943 CAGGCAAAGAGAGCTTGTGCAGG + Intergenic
932598799 2:73110623-73110645 CAGCCAAGAACAGCCTGTCTTGG - Intronic
933268266 2:80204934-80204956 CAGGGAAAGAGAGCTTGTGTAGG + Intronic
933584954 2:84169835-84169857 CAGGCAAAGAAAGCTTGTGCAGG - Intergenic
935239948 2:101169573-101169595 CAGGCAAAGAAAGATTGTGCAGG - Intronic
937085138 2:119166670-119166692 CAGGGAAAAACAGCCTATGCTGG - Intergenic
937243054 2:120474786-120474808 CAGGCAAAGGAAGCCTGGGTGGG - Intergenic
937477820 2:122230563-122230585 CAGGGAAAGAGATCCAGTGTTGG + Intergenic
938010730 2:127826855-127826877 CAGGCAGAGAGAGCTTGTGCAGG - Intergenic
938011084 2:127829438-127829460 CAGGCAAAGAGAGCTTATGCAGG - Intergenic
938608799 2:132925010-132925032 AAGGCACAGCCAGCCTCTGTAGG - Intronic
939695063 2:145313320-145313342 CAGGCAAACAAAGCTTGTGCAGG + Intergenic
939842645 2:147207285-147207307 CAGGCAAAAAGAGCTTGTGCAGG + Intergenic
940174604 2:150864332-150864354 CAGGCAAAGAGAGCTTGTGCAGG + Intergenic
940805297 2:158180529-158180551 CAGGCAGAGACAGCAAGTGCAGG + Intronic
941142676 2:161805134-161805156 CAGGCAAAGAGAGCTTGTGCAGG + Intronic
941320028 2:164042384-164042406 CAGGCAAAGAGAGCTTGTACAGG + Intergenic
941332398 2:164194785-164194807 CAGGCAAAGAGAGCATGTGCAGG - Intergenic
941486426 2:166087536-166087558 AAGGCAAGGGCAGCCTGTGTGGG - Intronic
941649952 2:168081848-168081870 TAGGCAAAGAGAGCTTGTGCAGG - Intronic
942123634 2:172802395-172802417 CAGGCAAAGAGAGCTTGTGCAGG + Intronic
942864770 2:180660009-180660031 CAGGCTAAGTCAGCATGTGTTGG + Intergenic
943447705 2:188009438-188009460 CTGGCCAAGAGAGACTGTGTAGG + Intergenic
943559860 2:189448039-189448061 CAGGCAAAAACAACTTGTGCAGG - Intronic
943749778 2:191499398-191499420 CAGGCAAAGAGAGCTTATGCAGG - Intergenic
943776619 2:191773355-191773377 CAGGCAAAGAGAGCTTGTGCAGG - Intergenic
943776895 2:191775282-191775304 CAGGCAAAGAGAGCTTGTGCAGG - Intergenic
943939534 2:193973960-193973982 CAGGCAAAGAGAGCTTGTATAGG - Intergenic
944471871 2:200062558-200062580 AAGGCAAAGACAGTGTGTCTGGG - Intergenic
944686197 2:202119998-202120020 CAGGCAAAGAGAGCTTGTGCAGG - Intronic
944701061 2:202246547-202246569 CAGGCAAAGAGAGCTTGTGCAGG - Intergenic
944761406 2:202818682-202818704 CAGGCAAAAAGAGCTTGTGTAGG - Intronic
944877985 2:203982349-203982371 CAGGCAAAGAGAGCTTGTGCAGG + Intergenic
945709356 2:213277126-213277148 CAGGCAAAGAGAGCTTGTGCAGG - Intergenic
946519321 2:220448264-220448286 CAGGCAAAGAGAGTTTGTGCAGG - Intergenic
947248434 2:228076088-228076110 CAGGCAAAGAGGGCTTGTGCAGG - Intronic
947345734 2:229187469-229187491 CAGGCAAAGAGAGCTTGTGCAGG + Intronic
948380456 2:237546982-237547004 GAGCCACAGTCAGCCTGTGTGGG - Intronic
1169338000 20:4773228-4773250 CAGGCAAAGAGAGCTTGTGCAGG + Intergenic
1169730603 20:8781773-8781795 CAGGCAAAGAGAACTTGTGCAGG + Intronic
1170078822 20:12449432-12449454 CAGGCAGAGAGAGCTTGTGCAGG - Intergenic
1170458722 20:16556811-16556833 CAGGGAAGGACTGGCTGTGTAGG - Intronic
1170551545 20:17481432-17481454 CAGGCTCACACAGCCAGTGTGGG + Intronic
1171314241 20:24173969-24173991 CATGCAAAGATAGGCTGTGTGGG - Intergenic
1172720434 20:36995817-36995839 CAGGCAAAGAGAGCTTGTGCAGG - Intergenic
1173004748 20:39131368-39131390 TAGGGAAAGACAGCGGGTGTTGG + Intergenic
1173045442 20:39505000-39505022 CAGGCAAAGAGAGTTTGTGCAGG - Intergenic
1176233915 20:64045430-64045452 CAGACACAGACAGCCTGGGGAGG - Intronic
1176287612 21:5026844-5026866 GAGGCAAAGACAGCAAGGGTAGG - Intronic
1176522582 21:7835806-7835828 CAAGCACAGGCAGCCTTTGTGGG + Intergenic
1176704515 21:10102255-10102277 CAGGCAAAGAGAGCTTGTGCAGG + Intergenic
1177068083 21:16464972-16464994 CAGGCAAAGAGAGGTTGTGCGGG - Intergenic
1177900289 21:26906074-26906096 GAGGCAAAGAGAGCATGTGCAGG - Intergenic
1178656602 21:34465818-34465840 CAAGCACAGGCAGCCTTTGTGGG + Intergenic
1178666779 21:34554854-34554876 CAGGCAAAGAGAGCTTGTGCAGG + Intronic
1179334689 21:40439759-40439781 CAGGCAAAGAGAGCTTGTGCAGG + Intronic
1179357957 21:40679096-40679118 AAGGCAAAGAGTGCCTGTGTTGG - Intronic
1179869569 21:44236631-44236653 GAGGCAAAGACAGCAAGGGTAGG + Intronic
1180948506 22:19709736-19709758 CAGGCAGAGACAGCTGCTGTGGG + Intergenic
1180977802 22:19859481-19859503 AATGGAAAGACATCCTGTGTTGG - Intergenic
1182879447 22:33720931-33720953 CAGGGAAAGAGAGCCTGCTTTGG + Intronic
1183179045 22:36246189-36246211 CAGGCAAAGTGATCTTGTGTAGG + Intergenic
1183227243 22:36558951-36558973 AAGGCAGAGAGAGGCTGTGTTGG + Intergenic
1183451249 22:37896563-37896585 CAGGCAAAGGCAGGCAGAGTGGG - Intergenic
1183648094 22:39138417-39138439 CCGGGGAAGACAGCCTGGGTGGG - Intronic
1184923253 22:47620423-47620445 CAGTCGAAGACAGCCTGCGATGG + Intergenic
1185418611 22:50722789-50722811 ATGGTAAAGACAGCCTGTGTCGG - Intergenic
950243127 3:11389560-11389582 CGGGAAAATACCGCCTGTGTGGG + Intronic
950744601 3:15077042-15077064 CAGGTAAAGCCATCCTGGGTTGG - Exonic
951113277 3:18831213-18831235 CAGGCAAAGAGAGCCTCTGCAGG - Intergenic
951446011 3:22781742-22781764 CAGGCAAAGAGAGCTTGTGCAGG + Intergenic
951868021 3:27329155-27329177 CAGGCAAAAAGAGCTTGTGCAGG - Intronic
953188248 3:40658479-40658501 CAGGCAAAGAGAGCATGCGCAGG + Intergenic
953747134 3:45583686-45583708 GAGGCAAAGGCCGCCTGTCTTGG - Intronic
953904428 3:46861341-46861363 CAAGCAAAGCCAGCCTGACTGGG - Intronic
954605359 3:51905134-51905156 CAGGCAAAGAGAGCTTGTGCAGG - Intergenic
954605684 3:51907375-51907397 CAGGCAAAGAGAGCTACTGTAGG - Intergenic
954634232 3:52062877-52062899 AAGCCCAAGACAGCCTGTGTGGG - Intergenic
954872906 3:53781230-53781252 AAGGCAAAGACATTCTGGGTTGG + Intronic
955435343 3:58893968-58893990 CAGGCAAAAAAAGCTTGTGCAGG + Intronic
956714558 3:72067200-72067222 CAGGTAAAGAGAGCTTGTGGAGG + Intergenic
956728599 3:72176987-72177009 CAGGCAAAGCCAGCAGTTGTTGG + Intergenic
956937599 3:74121084-74121106 CAGGCAAAGGGAGCTTGTGCAGG + Intergenic
957896450 3:86425946-86425968 CAAGCAAAGACAGCTTGTGCAGG + Intergenic
957945599 3:87058652-87058674 CAGGGAAAGAGAGCTTGTGTAGG + Intergenic
959017587 3:101153161-101153183 CAGGCAAAGAGAGCTTGTGTAGG - Intergenic
959017724 3:101154665-101154687 CAGGCAAAGAGAGCTTGTGTAGG - Intergenic
960564263 3:119117405-119117427 CAGGCAAAGAGAGCTTGTGCAGG + Intronic
960564541 3:119119341-119119363 CAGTCAAAGAGAGCTTGTGCAGG + Intronic
960866762 3:122209508-122209530 CAGACAAAGAGAGCTTGTGCAGG + Intronic
961064075 3:123859424-123859446 CAGGAATAGACAGACTGTGTTGG - Intronic
962570234 3:136705650-136705672 TAGGCAAAGAGAGCATGTGCAGG - Intronic
963060477 3:141221063-141221085 TGGGCAAAGTCAGCCTGTGGGGG - Intergenic
963072694 3:141318145-141318167 CAGGCAAAGAGAGCTTGTGCGGG + Intergenic
963357197 3:144223820-144223842 CAGGCAAAAAGAACTTGTGTGGG - Intergenic
963729795 3:148960125-148960147 CAGGCAAAGAGAGCTTATGCAGG + Intergenic
963971027 3:151429690-151429712 CATGCAAATACAGGCTCTGTAGG - Intronic
967078427 3:186026215-186026237 CAGGCAAAGAGAGCATGTGCAGG - Intergenic
967387260 3:188923915-188923937 TAATCAAAGACACCCTGTGTGGG - Intergenic
967396168 3:189011552-189011574 CAGGCAAAGAGAGCTTGTGCGGG + Intronic
968767025 4:2477626-2477648 CAGGCAAAGAGAGCTTGTGTAGG - Intronic
968927974 4:3559961-3559983 CAGGCACAGACAGGCTCAGTGGG - Intergenic
970031954 4:11686040-11686062 CAGGCAAAGAGAGTTTGTGCAGG + Intergenic
970089767 4:12391879-12391901 CAAGCAGAGAAAGCCTGTGGTGG + Intergenic
970094327 4:12445417-12445439 CAGGAAAAGAGAGCTTGTGCAGG + Intergenic
970363045 4:15329329-15329351 CAGGCAAAGAGAGCTTGTGCAGG - Intergenic
970771805 4:19622110-19622132 CAGGCAAAGAGAGCTTATGCAGG - Intergenic
970984641 4:22142204-22142226 CAGGCAAAAAGAGCTTGTGCAGG - Intergenic
971370915 4:26018149-26018171 CAGGCAAAGAGAGCTTGTACAGG + Intergenic
971705627 4:30038894-30038916 CAGGCAAAGAGAGCTTGTGCAGG + Intergenic
972056329 4:34807219-34807241 CAGGCAAGGACAACATGTGCAGG + Intergenic
972301284 4:37787755-37787777 CAGACAATGCCAGCCTGTGAAGG + Intergenic
972345287 4:38187885-38187907 CAGGCAAAGAGAGCTTGTGCAGG - Intergenic
972755358 4:42041054-42041076 CAGGCAAATAGAGCTTGTGCAGG + Intronic
972809066 4:42562796-42562818 CAGGCAAAGAGAGCTTGTGCAGG - Intronic
972816368 4:42651092-42651114 CAGGCAGAGAGAGCTTGTGCAGG - Intronic
973552170 4:52047178-52047200 CAGGCAGAGATAGCTTGTGCAGG + Intergenic
974178809 4:58359273-58359295 CAGGCAAAAAGAGCATGTGCAGG - Intergenic
975214419 4:71737375-71737397 CAGGCAAAGAGAGCTTGTGTGGG - Intergenic
975214679 4:71739272-71739294 CAGGCAAAGAGAGCTTGTGCAGG - Intergenic
975300282 4:72782407-72782429 CAGGCAAAGAGAGGTTGTGCAGG + Intergenic
976026881 4:80698763-80698785 CAGGCCAAGAGAGCATGTGAAGG + Intronic
976461758 4:85320334-85320356 CAGGGAAGGAAAGCCTCTGTGGG + Intergenic
976902196 4:90192194-90192216 CAGGCAAAGAGAGCTTGTGCAGG + Intronic
977545193 4:98368179-98368201 CAGGCAAACAGAGCTTGTGCAGG - Intronic
978389958 4:108215128-108215150 CACAGAAAGACAGCCTGTGATGG - Intergenic
978986738 4:115022819-115022841 CAGGCAAAGAGAGCTTGTGCAGG - Intronic
979426223 4:120571336-120571358 CAGGCAAAGACACCTTGTGCAGG + Intergenic
979426542 4:120573599-120573621 CAGGCAAAGAGAGCTTGTGCAGG + Intergenic
979730433 4:124017625-124017647 CAGGCAAATACTACATGTGTGGG + Intergenic
979810321 4:125028574-125028596 CAGGCAAAGAGAACTTGTGCAGG + Intergenic
980376725 4:131958579-131958601 CAGGCAAAGAGAGCTTGTGCAGG + Intergenic
980720267 4:136686618-136686640 CAGGCAGAGACAGCTTGTGCAGG + Intergenic
981121126 4:141052032-141052054 CAGGCAAAGAGAGCTTCTGCAGG + Intronic
981418546 4:144521650-144521672 CAGGCAAGGACAGGGTATGTGGG - Intergenic
981530056 4:145743740-145743762 CAAACAAAGACAGCTTGTGTAGG - Intronic
983601040 4:169528266-169528288 CAAGCAAAGGCAACCTGTGGAGG - Intronic
983880162 4:172923808-172923830 CAGGCAAAAAGAGCTTGTGCAGG + Intronic
984616568 4:181904944-181904966 CAGGCAAAGAGAGCTTGTGCAGG - Intergenic
985100449 4:186453012-186453034 CAGGCAAAGAGAGCTTGTGCAGG + Intronic
985533485 5:447781-447803 CATGCAAAGACAGCGTGAGTGGG - Intronic
985798034 5:1979131-1979153 CAGGAAGAGACAGCATGTGCAGG + Intergenic
985814377 5:2115690-2115712 CTGGCAAAGAGAGCGTGTGCGGG + Intergenic
986515339 5:8556259-8556281 CAGGCAAAGAGAGCTTGTACAGG - Intergenic
986649575 5:9949765-9949787 CAGGCAAAGAGAACTTGTGAAGG - Intergenic
986690682 5:10311264-10311286 CAGGAAAAGAGAGCTTGTGCAGG + Intergenic
986873600 5:12079963-12079985 CAGGCAAAGAGAGTTTGTGCAGG + Intergenic
987386705 5:17336916-17336938 CAGGCAAACAGAGCTTGTGCAGG + Intergenic
987680645 5:21132500-21132522 TAGGCAAAGAGAGCTTGTGCTGG - Intergenic
988004946 5:25397552-25397574 CAGGCAAAAAAAGCTTGTGCAGG + Intergenic
988091225 5:26543298-26543320 CAGGGAAAGAGAGCTTGTGCAGG + Intergenic
990400900 5:55436399-55436421 CAGGCAGAGAGAGCTTGTGCAGG - Intronic
990634891 5:57713692-57713714 CAGGCAAAGAGAGCTTGTGCAGG - Intergenic
990701678 5:58481465-58481487 CAGTGAAGGACAGCATGTGTAGG + Intergenic
990701779 5:58482211-58482233 CAGTGAATGACAGCATGTGTAGG + Intergenic
990701788 5:58482293-58482315 CAGTGAATGACAGCATGTGTAGG + Intergenic
990701796 5:58482375-58482397 CAGTGAATGACAGCATGTGTAGG + Intergenic
990701830 5:58482571-58482593 CAGTGAATGACAGCATGTGTAGG + Intergenic
990701854 5:58482734-58482756 CAGGGAGGGACAGCATGTGTAGG + Intergenic
990729707 5:58795147-58795169 CAGGCAAAGAGAGCATGTGTAGG - Intronic
991038710 5:62154337-62154359 CAGGCAAAGAGAGCTTGTGCAGG + Intergenic
991273829 5:64819570-64819592 CAGGCAAAGACAGCGTGTACAGG - Intronic
991494087 5:67210832-67210854 GAAGCAGAAACAGCCTGTGTGGG - Intergenic
991615893 5:68497000-68497022 CAGGCAAAGAGAACTTGTGCAGG - Intergenic
993029196 5:82684578-82684600 CAGCCAAGGACAGCATGTTTTGG + Intergenic
993770106 5:91916244-91916266 CTGGCTAAAACAGCCTGGGTTGG + Intergenic
994374900 5:99008266-99008288 CAGGCAAAGAGAGCTTGTGCAGG - Intergenic
994464659 5:100111592-100111614 CAGGCAAGGAAAGCATGTGCAGG + Intergenic
994464765 5:100112297-100112319 CAGGCAAGGAGAGCATGTGCAGG + Intergenic
994610539 5:102032354-102032376 CAGGCAAAGAGAGCTTGTGCAGG - Intergenic
995153541 5:108881339-108881361 CAGGCAAAGAGAGTTTGTGCAGG + Intronic
995276733 5:110285973-110285995 CGGGCAAAGAGAGCTTGTGCAGG + Intergenic
996152742 5:120059697-120059719 CAGGCAAAGAGAGCTTGTGAAGG + Intergenic
996164161 5:120204908-120204930 CAGGCAAAGAGAGCTTGTGCAGG + Intergenic
996448450 5:123586934-123586956 CAGGCAAAGAGAGCTTGTGCAGG + Intronic
996794006 5:127324602-127324624 GAGGCAAAGACAGAGTGTGGAGG - Intronic
997052279 5:130397475-130397497 CATGCAAAGAGAGCTTGTGCAGG - Intergenic
997052551 5:130399378-130399400 CAGGCAAAGAGAGTGTGTGCAGG - Intergenic
997148613 5:131466623-131466645 CAGGCAAAGAGAGTTTGTGCAGG - Intronic
997184058 5:131863853-131863875 CAGGCAGAGAGAGCTTGTGCAGG - Intronic
997274759 5:132575266-132575288 CAGGCAAAGAGAGCTTGTGCGGG + Intronic
997406083 5:133648001-133648023 CAGGCAAAGAGAGCTTGTGCAGG - Intergenic
997753802 5:136375403-136375425 CTTGCTGAGACAGCCTGTGTCGG + Intronic
998907069 5:146917232-146917254 ACAGCAAAGACAGCCTGTGCAGG - Intronic
999012172 5:148055182-148055204 CAGGCAAAGAGAGCTTGTGCAGG - Intronic
999301243 5:150491930-150491952 CAGGCAAAGTGAGACTGGGTGGG - Intronic
1000176777 5:158763828-158763850 TAAGCAAATACATCCTGTGTTGG + Intronic
1000496478 5:161990720-161990742 CAGGCAAAGAGAGCTTGTGCAGG + Intergenic
1001143347 5:169163463-169163485 CTGGCTCAGAAAGCCTGTGTCGG - Intronic
1002345162 5:178543705-178543727 CAGGCTAAGACAGGCCGTTTTGG - Intronic
1003643167 6:7892685-7892707 CAGGCAAAAAGAGCTTGTGTAGG - Intronic
1006402134 6:33823956-33823978 GTGGCAGAGACAGCCAGTGTGGG + Intergenic
1008298206 6:49803996-49804018 CAGGCAAAAAGAGCCTGTGCAGG - Intergenic
1008323643 6:50149546-50149568 CAGGCAAAGAGAGCTTGTATAGG - Intergenic
1008566992 6:52778245-52778267 CCAGCAAATACAACCTGTGTGGG - Intergenic
1008570540 6:52812310-52812332 CCAGCAAATACAACCTGTGTGGG - Intergenic
1008681316 6:53876184-53876206 CAGGCAAAGAGAGCTTGTGCAGG + Intronic
1008681590 6:53878075-53878097 CAGGCAAAGAGAGCTTGTGCAGG + Intronic
1008821061 6:55630750-55630772 CAGGCAAAGAGAGCTTGTGTAGG - Intergenic
1009503029 6:64441745-64441767 CAGGCAGAGATAGCTTGTGCAGG - Intronic
1009990420 6:70836294-70836316 CAGGCAAAGACAGCCTGTGTAGG + Intronic
1010280513 6:74018123-74018145 CAGTCAAAGAGAGCTTGTGTGGG - Intergenic
1010452761 6:76020936-76020958 CATGCAAAGTCATCCTTTGTGGG + Intronic
1010550902 6:77221652-77221674 CAGGCAAAGAGAGCTTGTGCTGG - Intergenic
1010551178 6:77223570-77223592 CAGGCAAAGAGAGCTTGTGCAGG - Intergenic
1010764982 6:79768925-79768947 CAGGCAAAGAGAGCTTGTGCAGG + Intergenic
1011144382 6:84196267-84196289 CAGGCAAAGAGAGCTTGTGCAGG - Intronic
1012248706 6:96956084-96956106 CAAGCAAAGAGAGCTTGTGCTGG + Intronic
1014133587 6:117863123-117863145 CAGGCAAAAAGAGCATGTGCAGG - Intergenic
1014585989 6:123198829-123198851 CAGGGAAAGAGAGCTTGTGCAGG - Intergenic
1014586551 6:123204242-123204264 AAGGTGAAGACAGACTGTGTTGG + Intergenic
1014766631 6:125414716-125414738 CAGGCAAAAAGAGCTTGTGCAGG + Intergenic
1015013049 6:128375370-128375392 CAGGCAAAGAGAGCTTGTGCAGG + Intronic
1015053667 6:128874261-128874283 CAGGCAAAGAGCACCTGTGCAGG - Intergenic
1015702822 6:136054849-136054871 CAGGCAAAGAGAGTGTGTGCAGG + Intronic
1016084966 6:139902268-139902290 CAGGCAAAGAGAGCTTGTGCAGG - Intergenic
1016304192 6:142666247-142666269 CAGGCCAAGAGAGCATGTGCAGG + Intergenic
1016311325 6:142736795-142736817 TAGGCAAAGAGAGCTTGTGCAGG + Intergenic
1016539828 6:145151902-145151924 CAGGAACAGATAGCCTGTGGTGG + Intergenic
1017323619 6:153121225-153121247 TTGGTAAATACAGCCTGTGTGGG - Intronic
1018962940 6:168461161-168461183 GAGGCAAAGAGAGCTTGTGCAGG + Intronic
1019093208 6:169557323-169557345 CAGACAAAGCCAGTCTGTGATGG + Intronic
1019176545 6:170162195-170162217 CAGGCACAGACAGCCCCTGGGGG + Intergenic
1019191147 6:170251659-170251681 CAGGAAAAGGCGGCCTGTGGGGG - Intergenic
1020869349 7:13607935-13607957 CAGTCAATGCCAGCCTGTGAAGG + Intergenic
1020885776 7:13817406-13817428 CAGGCAGAGACAGCTTGTGCAGG - Intergenic
1022459177 7:30587757-30587779 CAGGCAAAGAGAGCTTGTGCAGG + Intergenic
1022493013 7:30835273-30835295 CAGGCAAAGAGAGCTTGTGCAGG + Intronic
1022535058 7:31093419-31093441 CAGGCAAAGATAGGCTGTTAGGG - Intronic
1022810153 7:33860605-33860627 CAAGCAAAGAGAGCTTGTGCAGG - Intergenic
1023083300 7:36545584-36545606 TGGGCACAGACACCCTGTGTGGG + Intronic
1023137966 7:37072376-37072398 CAGGCAAAGAGAGCTTGTGCAGG - Intronic
1023795958 7:43792345-43792367 CAGGCAAAGCTAGCCGCTGTGGG + Intronic
1024211944 7:47213599-47213621 CAGGCAGTGAGACCCTGTGTTGG - Intergenic
1024404422 7:48962365-48962387 CAGGCAAAGACAGATGGAGTCGG - Intergenic
1024614225 7:51095200-51095222 CAGGCAAAGACAGCATGTGCAGG + Intronic
1025069210 7:55884320-55884342 GATGCAAAGACAACCTTTGTGGG - Intergenic
1027300531 7:76828973-76828995 CAGGCAAAAAAAGCTTGTGCAGG + Intergenic
1027651424 7:80873268-80873290 CAGGCACAGCCAGACTGTGCAGG + Intronic
1027690206 7:81336290-81336312 CAGGCAAAAAAAGCTTGTGCAGG + Intergenic
1027849876 7:83436981-83437003 CAAGCAAAGAGAGCTTGTGCAGG + Intronic
1029635924 7:101783715-101783737 CAGGCAAAGAGAGCTTATGCAGG - Intergenic
1030600339 7:111584702-111584724 CAGGCAAAGCCACCCTGAGTGGG + Intergenic
1030924176 7:115430947-115430969 CAAGCAAAGAGAGCTTGTGCAGG + Intergenic
1031778891 7:125938415-125938437 CTGGCAAAGACAGCGTGTGCAGG - Intergenic
1032892033 7:136207313-136207335 CAGGCAAAGAAGGCATGTGCAGG - Intergenic
1032897574 7:136268479-136268501 CAGGCAAAGAGAGCATGTGCAGG + Intergenic
1033475024 7:141683703-141683725 CAGACAAAGACAGACTCTATAGG + Intronic
1033663573 7:143420850-143420872 CAGGCACAGAGAGCTTGTGCAGG + Intergenic
1033777335 7:144627333-144627355 CAGGCAAAGAGAGCTTGTTCAGG + Intronic
1033786983 7:144743803-144743825 CAGGCAAAGAGAGTGTGTGCAGG - Intronic
1034297997 7:149991136-149991158 CAGACAAAGACAGCAAGTGCAGG + Intergenic
1034808023 7:154105717-154105739 CAGACAAAGACAGCAAGTGCAGG - Intronic
1035371183 7:158379924-158379946 CAGGCAAAGAGAGCTTGTATGGG + Intronic
1035992663 8:4510130-4510152 CAGGCAAAGGGAGCGTGTGAAGG - Intronic
1036208403 8:6822198-6822220 CATGCAAAGATAAACTGTGTTGG - Intronic
1036399083 8:8392450-8392472 CAGGCAAAGAGAGCTCGTGTAGG + Intergenic
1037021599 8:13978425-13978447 CAAGCAAAGAGAGCTTGTGCAGG + Intergenic
1037298639 8:17427999-17428021 CAGGCAGAGAGAGCTTGTGCAGG + Intergenic
1037332073 8:17752797-17752819 CACCCAAGGACAGCCTGTCTGGG + Intronic
1037471831 8:19218224-19218246 CAAGCAAAGACAGCTTGTGCAGG + Intergenic
1037618873 8:20545606-20545628 CAGGCAAAGACAGACCATGGAGG + Intergenic
1037975445 8:23207733-23207755 CAAGCAAAGAGAGCTTGTGCAGG - Intronic
1038094530 8:24293127-24293149 CAGGCAAAGAGAGCCTGAGCAGG + Intergenic
1038410232 8:27352740-27352762 CAGGCAAAAAGAGCTTGTGCAGG - Intronic
1039008547 8:33068263-33068285 GAGGCAAAAACTGCCTGGGTGGG + Intergenic
1039964959 8:42277542-42277564 CAGGTGCAGACAGACTGTGTGGG - Intronic
1040545173 8:48393349-48393371 CAGCCAAAGAGGGGCTGTGTTGG + Intergenic
1041618653 8:59938231-59938253 CAGGCAAAAAGAGCTTGTGCAGG - Intergenic
1041947248 8:63459993-63460015 CAGGCAAAGCCAGACTGCGAAGG - Intergenic
1041953899 8:63536470-63536492 CAGGCAAAGAGAGCTTGTACAGG + Intergenic
1042585395 8:70332719-70332741 CAGGCCAAGAAAGCAAGTGTTGG - Intronic
1042660907 8:71153467-71153489 CAGGCAAAAAGAGCTTGTGCAGG + Intergenic
1043078938 8:75740171-75740193 CAGGTAAAGAGAGCTTGTGCAGG + Intergenic
1043425982 8:80149295-80149317 CAGGCAAGGAGAGCGTGTGCAGG - Intronic
1044610947 8:94091631-94091653 CAGGCAAAGAGGGTTTGTGTAGG - Intergenic
1045180617 8:99777406-99777428 CAGGCTAAGAGAGCTTGTGCAGG + Intronic
1045611169 8:103844034-103844056 CAGGCAAATAAAGCTTGTGCAGG - Intronic
1045872329 8:106940797-106940819 CAGGCAAAGAGAGCTTGTGCAGG + Intergenic
1045919451 8:107512076-107512098 CAGGCAAAGAGAGCATGTGCAGG - Intergenic
1045995787 8:108359893-108359915 CAGGCAAAGAGAGCTTGTTCAGG + Intronic
1046003979 8:108457565-108457587 CAGGCAAAGAGAGCTTGTGCAGG + Intronic
1046004256 8:108459502-108459524 CATGCAAAGAGAGCTTGTGCAGG + Intronic
1046050280 8:109013588-109013610 CAGGCAAAGACAGCTTGGGCAGG - Intergenic
1046159535 8:110342245-110342267 CAGGCAAAGAGAGCTTGGGCAGG + Intergenic
1046207071 8:111014903-111014925 CAGGCAAAGAAAGCTTATGCAGG - Intergenic
1046207270 8:111016310-111016332 CAGGCAAAGAAAACTTGTGCAGG - Intergenic
1046251755 8:111642128-111642150 CAGGCAAAGAGAGCTTATGCGGG + Intergenic
1046814669 8:118570908-118570930 CAGGCAAAGAGAGCTTGTGCAGG - Intronic
1046814908 8:118572618-118572640 CAGGCAAAGAGAGCTTGTACAGG - Intronic
1047149202 8:122241568-122241590 CACTCAATGACAGCCTGTGAAGG + Intergenic
1047149289 8:122242212-122242234 CAGGCAAAAAGAGCGTGTGCAGG - Intergenic
1047258882 8:123238284-123238306 CAGGCAAAGAGAGTGTGTGCAGG - Intronic
1047577566 8:126174516-126174538 CAGGCAAAGAGAGCTTGTGCAGG - Intergenic
1047591202 8:126329405-126329427 CAGGCAAAAAGAGCCTGTGCAGG - Intergenic
1048020477 8:130534024-130534046 CAGGCAAAGAGAACTTGTGCAGG + Intergenic
1048313836 8:133347627-133347649 CAGGCAAAGAGAGCTTGTGCAGG - Intergenic
1048419202 8:134260632-134260654 CAGGCAAAAAGAGCTTGTGCAGG - Intergenic
1048419475 8:134262569-134262591 CAGGCAAAAAGAGCTTGTGCAGG - Intergenic
1048429476 8:134356344-134356366 CAAGCAAAGAGAGCTTGTGGAGG + Intergenic
1048504872 8:135012144-135012166 CAGGCAAAGAGAGCTTGTGCAGG - Intergenic
1048505137 8:135014080-135014102 CAGGCAAAGAGAGCTTGTCCAGG - Intergenic
1048895638 8:138989977-138989999 CATGCAAAGAGAGCATGTGCAGG + Intergenic
1049293595 8:141817607-141817629 CAGGCAACCACAGCCTCCGTGGG - Intergenic
1049395076 8:142396314-142396336 CAGGCAACCACAGCCTCTGGGGG + Intronic
1050156825 9:2676178-2676200 CAGGCAAAGAGAGAGTGTGCAGG - Intergenic
1050177583 9:2884190-2884212 AAGGCAATGCCAGCCTCTGTTGG + Intergenic
1050656104 9:7830662-7830684 CAAGCAAAGAGAGCTTGTGTAGG + Intronic
1050742660 9:8840352-8840374 CAGGCAAAGAGAGTTTGTGCAGG - Intronic
1050903968 9:10980602-10980624 CAGGCAAAGAGAGTGTGTGCAGG + Intergenic
1051089203 9:13386121-13386143 CAGGCAAAGAGAGCTTGTGCAGG - Intergenic
1051217043 9:14809159-14809181 CAAGCAAAGAGAGCTTGTGCAGG - Intronic
1051888432 9:21918753-21918775 CAGGCAAAGAGGGCATGTGCAGG - Intronic
1052080686 9:24202441-24202463 CAGGCAAAGAGAGCTTGTGAAGG - Intergenic
1052102484 9:24465951-24465973 CAGTAAAAGACAGCCTGTGTTGG + Intergenic
1052301523 9:26957779-26957801 AAGGCAAACAAAGCGTGTGTTGG - Intronic
1052655780 9:31358299-31358321 CAGGCAAAGAGAGCTTATGCAGG + Intergenic
1053641772 9:40089262-40089284 CAGGCAAAGAGAGCTTGTGCAGG + Intergenic
1053764364 9:41376202-41376224 CAGGCAAAGAGAGCTTGTGCAGG - Intergenic
1053802832 9:41775042-41775064 CAGGCACAGACAGGCTCAGTGGG - Intergenic
1054142415 9:61540028-61540050 CAGGCACAGACAGGCTCAGTGGG + Intergenic
1054191137 9:61986388-61986410 CAGGCACAGACAGGCTCAGTGGG - Intergenic
1054322662 9:63686651-63686673 CAGGCAAAGAGAGCTTGTGCAGG + Intergenic
1054462159 9:65471178-65471200 CAGGCACAGACAGGCTCAGTGGG + Intergenic
1054542979 9:66287380-66287402 CAGGCAAAGAGAGCTTGTGCAGG - Intergenic
1054647232 9:67601329-67601351 CAGGCACAGACAGGCTCAGTGGG + Intergenic
1055165385 9:73185365-73185387 CAGGCAAAAAGAGCATGTGTGGG - Intergenic
1055487035 9:76766305-76766327 CAGGCAAAGCCTATCTGTGTGGG + Intronic
1055896491 9:81182536-81182558 CTGGCAGAAATAGCCTGTGTGGG + Intergenic
1056271703 9:84953927-84953949 AAGGCAAAGACAGTCACTGTAGG + Intronic
1056810031 9:89757089-89757111 GAGGCGAGGACAGCGTGTGTTGG + Intergenic
1057705218 9:97390950-97390972 CAGGCAAAAAGAGCTTGTGCAGG + Intergenic
1057935829 9:99238009-99238031 CAGGCAAAGAGAGCTTGTTCAGG - Intergenic
1058109377 9:101015541-101015563 CAGACAAAGAACCCCTGTGTTGG - Intergenic
1058141062 9:101357327-101357349 CAGGCTAAGAGAGCTTGTGCAGG + Intergenic
1058337909 9:103855646-103855668 CAGGCAAGGAGAGCATGTGCAGG - Intergenic
1058380322 9:104370801-104370823 CAGGAAAAGAAAGCTTGTGCAGG - Intergenic
1058447766 9:105068882-105068904 CAGCCAAAAACAGGCTGTTTGGG + Intergenic
1058961376 9:109995586-109995608 CAGGCAAAGAGAGCATGTGCAGG + Intronic
1058987713 9:110224312-110224334 CAGGCAAAGAGGGCTTGTGCAGG - Intergenic
1059239685 9:112793425-112793447 CAGGCAAATACACCAAGTGTGGG - Intronic
1060548706 9:124475375-124475397 CAGGCAAGGCCAGGCTGTGGGGG + Intronic
1060554816 9:124502869-124502891 CTGGCAAGGCCAGCCTGGGTTGG - Intronic
1060751974 9:126176122-126176144 CAGGCAAAGAGGGCCTGTCCAGG + Intergenic
1202789549 9_KI270719v1_random:72347-72369 CAGGCAAAGAGAGCTTGTGCAGG + Intergenic
1186046237 X:5539340-5539362 GAGGCAAAGAGAGCTTGCGTAGG - Intergenic
1186223770 X:7375952-7375974 CAGGCAAAGAGAGCTTGTTCAGG - Intergenic
1186926904 X:14343585-14343607 CAGGCAAAGAGAGCTTGTGCAGG - Intergenic
1187260871 X:17684076-17684098 CAGGCAAAGAGAGCATATGCAGG - Intronic
1187440347 X:19312462-19312484 CAGGCAAAGAGAACTTGTGTAGG + Intergenic
1189021706 X:37348848-37348870 CATCCACAGACCGCCTGTGTAGG - Intergenic
1190216254 X:48481391-48481413 AAGGCAAAGACAGCGGGTGAGGG - Intronic
1190221156 X:48513034-48513056 CAGCCAGAGACAGTATGTGTTGG - Intronic
1190607073 X:52154825-52154847 CAGGAAAAGACAACAAGTGTTGG + Intergenic
1192442541 X:71185376-71185398 GAGGCACAGACAAACTGTGTGGG + Intergenic
1192866923 X:75143723-75143745 TAGGCAAAGAGAGCTTGTGTAGG + Intronic
1193236584 X:79114312-79114334 CAGACAATGCCAGCCTGTGAAGG - Intergenic
1194182886 X:90735258-90735280 CAGGCAAAAAGAGCTTGTGTAGG - Intergenic
1194320476 X:92440575-92440597 CAGGCAGAGAGAGCTTGTGCAGG - Intronic
1194501797 X:94690664-94690686 CACTCAATGACAGCCTGTGAAGG + Intergenic
1195478366 X:105314460-105314482 CAGGCTAAGCCAGACTGTGTCGG + Intronic
1195558473 X:106255194-106255216 CAGGCAAAGAGAGTTTGTGCAGG + Intergenic
1195656123 X:107333027-107333049 CAGGCAAAGAGAGCTTGTGCAGG - Intergenic
1196067199 X:111477380-111477402 CAGGCAAAAAGAGCATGTGCAGG + Intergenic
1196170655 X:112584692-112584714 CAGGCAAAGAAAACTTGTGCAGG + Intergenic
1196259131 X:113557291-113557313 CAGGCAAAGAGAGCTTGTGCAGG + Intergenic
1196321922 X:114351287-114351309 CAGGCAAAAAAAGCATGTGCAGG - Intergenic
1196530568 X:116782075-116782097 CAGGCAAAAACGGCCTGCTTGGG - Intergenic
1196567806 X:117229549-117229571 CAGGCAAAGAGGGCTTGTGCAGG + Intergenic
1196567996 X:117230913-117230935 CAGGCAAAGAGAGCTTGTGTAGG + Intergenic
1197002958 X:121460733-121460755 CAGGCAAAGAGAACTTGTGCAGG - Intergenic
1197103819 X:122689207-122689229 CAGGCAAAGAGAGCTTGTGCAGG - Intergenic
1197921414 X:131598619-131598641 CAGGCAAAGAGACCATGTGCAGG + Intergenic
1198112592 X:133514773-133514795 CAGGGAAGCAAAGCCTGTGTTGG + Intergenic
1198569033 X:137935411-137935433 CAGGTAAAGAGAGCTTGTGCAGG - Intergenic
1198644880 X:138795504-138795526 CAGGAACACACAGCCTATGTTGG + Intronic
1199193098 X:144995564-144995586 CAGGCAAAGAGAGCTTGTGCAGG - Intergenic
1199494260 X:148435829-148435851 CAAGCAAAGAGAGCTTGTGCAGG + Intergenic
1199602713 X:149552151-149552173 CAGGCCAAGACTTGCTGTGTAGG + Intergenic
1199621464 X:149705364-149705386 CAGGCAAAGAGAGCTTGTGCAGG - Intronic
1199647675 X:149927324-149927346 CAGGCCAAGACTTGCTGTGTAGG - Intergenic
1200529505 Y:4317213-4317235 CAGGCAAAAAGAGCTTGTGTAGG - Intergenic
1200628590 Y:5553705-5553727 CAGGCAGAGAGAGCTTGTGCAGG - Intronic
1201319753 Y:12685148-12685170 CAGGCAATCACAGCCTGCTTTGG - Intergenic