ID: 1009993682

View in Genome Browser
Species Human (GRCh38)
Location 6:70876007-70876029
Sequence GCCCACTAAAAAATAATTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 224}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009993682_1009993684 19 Left 1009993682 6:70876007-70876029 CCATGAATTATTTTTTAGTGGGC 0: 1
1: 0
2: 1
3: 16
4: 224
Right 1009993684 6:70876049-70876071 AGAACCAAAAAGACTCTGATGGG 0: 1
1: 0
2: 3
3: 11
4: 216
1009993682_1009993683 18 Left 1009993682 6:70876007-70876029 CCATGAATTATTTTTTAGTGGGC 0: 1
1: 0
2: 1
3: 16
4: 224
Right 1009993683 6:70876048-70876070 TAGAACCAAAAAGACTCTGATGG 0: 1
1: 0
2: 1
3: 13
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009993682 Original CRISPR GCCCACTAAAAAATAATTCA TGG (reversed) Intronic
903988053 1:27243511-27243533 GGCCACTAAATAATAATTACTGG - Intronic
905897143 1:41555634-41555656 GCACACTTAAAAATGGTTCAGGG - Intronic
906349679 1:45047538-45047560 GTACACTCAAGAATAATTCATGG + Intronic
908836700 1:68235348-68235370 GCTCATTAAAAACTAAGTCAAGG - Intergenic
909796747 1:79749039-79749061 GCACTCTAAAAAATAACCCATGG + Intergenic
910969987 1:92846175-92846197 GCACACAGAAAAAAAATTCATGG + Intronic
912138906 1:106697164-106697186 GCCCCCAAAAAACTAATACAAGG + Intergenic
913032932 1:114930074-114930096 TCAGACTAATAAATAATTCATGG + Intronic
915077057 1:153317106-153317128 GTGCACTAAAAAATAATAAAGGG - Intergenic
920388245 1:205582760-205582782 GCACACTCAAAAAGAAGTCAAGG - Intronic
920886141 1:209930227-209930249 CCCAACAAAATAATAATTCAAGG - Intergenic
921165075 1:212501008-212501030 GCACACTGAGAAACAATTCAAGG - Intergenic
923262729 1:232282872-232282894 ACCAACTATAAAATAATCCAGGG - Intergenic
924128322 1:240879278-240879300 GTCAAGTAAAAAATAATCCAAGG - Intronic
924532930 1:244908681-244908703 TCTCAATACAAAATAATTCACGG - Intergenic
924648159 1:245899403-245899425 TTCCACTAGAAAATATTTCATGG + Intronic
924828724 1:247570055-247570077 ACACACTAAAAAATAATAGAGGG - Intronic
1063548801 10:7008322-7008344 GCCAAATAATAAATAATTGAAGG + Intergenic
1065642457 10:27798149-27798171 ACCCACTTCTAAATAATTCATGG - Intergenic
1067192908 10:44087135-44087157 TCCCACTAAAACAAAATTCAGGG + Intergenic
1069166004 10:65159892-65159914 CCCCACTTAAAAAGAACTCAAGG - Intergenic
1071472935 10:85998369-85998391 GCACACTTATAAATAATCCATGG + Intronic
1071595664 10:86921928-86921950 GTACACTTAAAAATAACTCAAGG - Intronic
1071892175 10:90022083-90022105 GCCCAATATAAAATAAGCCAGGG + Intergenic
1071989514 10:91087826-91087848 GCCCACTAAAAAGTAATATTAGG - Intergenic
1076198131 10:128535459-128535481 TCCCAATAAATAATAAGTCATGG + Intergenic
1079150091 11:17890746-17890768 CTCCACTAAAAAATTATTCTTGG + Intronic
1079459183 11:20665116-20665138 GCACTCTAAAAAATAAAGCAGGG + Intergenic
1080411164 11:32026215-32026237 GAACAATAAAAAAGAATTCAAGG + Intronic
1080881349 11:36323727-36323749 GCCTACTAAAAATTATTTGAAGG + Intronic
1082860521 11:57851356-57851378 GCCAACCAAAAAAAAATCCAGGG + Intergenic
1083073190 11:60008473-60008495 ACACAATAAAAAATAATACAGGG - Intergenic
1083767839 11:64850535-64850557 GACCAGTAAAAAATAAATAATGG - Intergenic
1088236081 11:107724917-107724939 TCCCACTAAATAATAGATCAAGG - Intergenic
1088753087 11:112862227-112862249 TCCCACTAAAAAATGATCCCTGG - Intergenic
1092873387 12:12827059-12827081 GCCCATTAGAAAATCACTCAAGG - Intronic
1096327211 12:50674742-50674764 GCCCACTAATAACTAATCCTGGG + Intronic
1097888703 12:64755965-64755987 GCTCTTTTAAAAATAATTCATGG - Intronic
1098787651 12:74780303-74780325 ACACACTAGAGAATAATTCACGG - Intergenic
1099564707 12:84228853-84228875 GCCCAAAGAAGAATAATTCAGGG - Intergenic
1102674836 12:114650347-114650369 GCCAACTAAACACTAATTCAAGG + Intergenic
1103194851 12:119034752-119034774 GTCCACAAGCAAATAATTCAAGG - Intronic
1105752082 13:23430443-23430465 ACATACTAAAAAATAATTCGTGG - Intronic
1108462886 13:50684757-50684779 GGCCATAAAGAAATAATTCAGGG + Intronic
1108476832 13:50828396-50828418 ACCCACTTCTAAATAATTCATGG + Intronic
1108900879 13:55406727-55406749 TCTCACGCAAAAATAATTCAGGG - Intergenic
1110005638 13:70263661-70263683 TCCCAATGAAAAATTATTCAAGG + Intergenic
1112505597 13:99972988-99973010 GCCCACCAAAAAGTGATGCAGGG - Intergenic
1114053843 14:18948483-18948505 GCTTACTAAAAAATAAGTAAAGG + Intergenic
1114108712 14:19453442-19453464 GCTTACTAAAAAATAAGTAAAGG - Intergenic
1114412468 14:22514046-22514068 GTACACTGAAAAATAATTCAAGG - Intergenic
1115229315 14:31141976-31141998 GTCCAAAAAAAAATAATTTAAGG + Intronic
1115803990 14:37030448-37030470 GGCAACTAAAAGATTATTCAAGG - Intronic
1116692646 14:48129839-48129861 ACCCACTAATAAATCAGTCATGG - Intergenic
1120587475 14:86330934-86330956 GTACACTCAAAAATAATTAAGGG + Intergenic
1121472805 14:94168487-94168509 ATTCACTAAAAAATATTTCAAGG - Intronic
1125840821 15:42799734-42799756 GCCAAATAAAAAGTAATGCAGGG - Intronic
1126796550 15:52264655-52264677 CCCACCTAAAAAATAATTCAGGG - Intronic
1126866752 15:52945126-52945148 GCTGACTAAAAAGTATTTCATGG - Intergenic
1127805169 15:62512661-62512683 GCCAACCATAAAAAAATTCATGG + Intronic
1128822922 15:70677676-70677698 TCCCTCTAAAAAATGATTTATGG + Intronic
1129434719 15:75529283-75529305 GCCTACAAAAAAATTATTCCTGG - Intronic
1130605179 15:85309345-85309367 GCCAACAAAAAAAAAATTCCAGG + Intergenic
1137021367 16:35431294-35431316 CCCCTCTAAAAAATAATTAGAGG + Intergenic
1137471749 16:48766540-48766562 GCACATTTAAAAATAATTCATGG + Intergenic
1139307579 16:66000531-66000553 GCACACTGAAAAATCATCCAAGG - Intergenic
1141872406 16:86796612-86796634 ACCCACTAAAAAATAAGCTAGGG - Intergenic
1142783494 17:2200928-2200950 GCCAATTAAAAAATAAATAATGG - Intronic
1143879656 17:10020182-10020204 GCCCCCTAGAAAATCACTCACGG + Intronic
1144251601 17:13422167-13422189 GCCCCCCAAAAAAGAATTTAGGG + Intergenic
1145711638 17:26983598-26983620 CCCCACTTAAAAAAAATTTAAGG - Intergenic
1148433290 17:47660851-47660873 GACCACTAACAAAGACTTCAGGG - Intronic
1149932168 17:60767645-60767667 GTCCAATAAAAAAAGATTCATGG - Intronic
1150197300 17:63313589-63313611 GCCAATTAAAAAATAATTTTTGG - Intronic
1150607368 17:66705844-66705866 GCCCCCTAAAATAAAATTAAGGG + Intronic
1150924448 17:69517887-69517909 TCACACTTAAAAATAATTAATGG + Intronic
1153079312 18:1202476-1202498 GTTCACTTATAAATAATTCATGG - Intergenic
1154032982 18:10769495-10769517 GCCCTCTAAAAATTAATCAAGGG - Intronic
1154184090 18:12166538-12166560 GGAAACTAAAAAAAAATTCAAGG - Intergenic
1155089884 18:22496640-22496662 ACCCACTTATAAATAATCCATGG + Intergenic
1156076636 18:33287247-33287269 GCATACCAAAAAATAATGCATGG + Intronic
1156358553 18:36363441-36363463 GCTAAATAAAAAATATTTCATGG - Intronic
1157235054 18:45956893-45956915 GTTCACTAAAAAATAAGTTATGG + Intronic
1157264272 18:46203938-46203960 GCCCACTAAAAAACAAACTAGGG - Intronic
1158169317 18:54578463-54578485 GCCAACTAAAATATTACTCAAGG + Intergenic
1163501984 19:17681659-17681681 GCTCATTAAATAGTAATTCACGG + Intronic
1165639653 19:37373606-37373628 GCTGAGAAAAAAATAATTCAGGG + Intronic
1168541538 19:57215767-57215789 GCATACTATTAAATAATTCATGG - Exonic
927336067 2:21926034-21926056 TCCCAGGAAGAAATAATTCAAGG - Intergenic
927406592 2:22777317-22777339 TCACATTAAAAAATAAGTCAGGG + Intergenic
928746091 2:34417694-34417716 GGCCACTTAAAAATGTTTCAGGG - Intergenic
929633291 2:43488855-43488877 GCCCACTAAAATAAAATGCATGG - Intronic
931047367 2:58370807-58370829 AACCACTGAAAAATAATACAAGG + Intergenic
931577508 2:63734176-63734198 GCACACTAGAAAAAAATTAAAGG - Intronic
933099227 2:78230488-78230510 GGCAAATAAAAAATAATTCCTGG + Intergenic
933189479 2:79317990-79318012 GCCCATTCAAAAATATTTCTTGG + Intronic
933342179 2:81037867-81037889 GCACATCAATAAATAATTCATGG - Intergenic
935008868 2:99112314-99112336 TCCCTCAAAAAAATAATACAAGG + Intronic
935545117 2:104392919-104392941 GCATACTGAAAAATAATTCATGG - Intergenic
935868824 2:107422777-107422799 AACCACTCAAAAATATTTCAAGG + Intergenic
938471832 2:131571240-131571262 GCTTACTAAAAAATAAGTAAAGG + Intergenic
940566469 2:155368364-155368386 GATCAGTAAAAAATAATCCAAGG + Intergenic
940577857 2:155536120-155536142 GCCAACTCAAAAATATTTAAAGG + Intergenic
940853493 2:158710325-158710347 GCACACTTCAAAATAATCCATGG - Intergenic
942335267 2:174877559-174877581 CCCTAATAAAAAATAGTTCAGGG - Intronic
942961667 2:181837004-181837026 CCCCATTAAAAAATATTACATGG - Intergenic
944049142 2:195447188-195447210 GCCCACCAAAATGTAATTCTAGG + Intergenic
944940627 2:204621475-204621497 GCACAGTCAAAATTAATTCAAGG - Intronic
945809797 2:214534921-214534943 GCCCACTGGAAAACAATTCAAGG - Intronic
947075219 2:226335633-226335655 GCCTACAAAATAATAATACATGG - Intergenic
947416026 2:229897344-229897366 GACAACTAAAAAATAAATAAGGG + Intronic
947513255 2:230778609-230778631 TCCCATTAAAAAATAAAACAGGG - Intronic
948319883 2:237060926-237060948 GCTCACTACAAAAGAATTCCAGG - Intergenic
1169835577 20:9874084-9874106 GCACAGAAAAAATTAATTCATGG - Intergenic
1174788248 20:53453477-53453499 GCACAGGAAAAAAAAATTCATGG - Intronic
1175730714 20:61352018-61352040 GCACACTTAAAAATAACTAAAGG - Intronic
1176176200 20:63726491-63726513 GCCTATTAAAAAAAAATTCAAGG - Intronic
1178755597 21:35346490-35346512 GCTCATTCAAAAATATTTCATGG + Intronic
1179053356 21:37908739-37908761 CACCACTAAAGAATGATTCAAGG + Intronic
1180472313 22:15670864-15670886 GCTTACTAAAAAATAAGTAAAGG + Intergenic
1181754754 22:25015964-25015986 GCTCAATAAAAAATAGTTGAGGG - Intronic
1184590489 22:45478939-45478961 TCCGTCTAAAAAAAAATTCATGG + Intergenic
1203243856 22_KI270733v1_random:45245-45267 GACCTCACAAAAATAATTCATGG + Intergenic
950084057 3:10244431-10244453 ACCTAAAAAAAAATAATTCAGGG - Intergenic
951685345 3:25337723-25337745 GCACACAAAAAAATAAAGCAGGG - Intronic
953142464 3:40241456-40241478 GTCCCCTAAAGTATAATTCATGG + Intronic
953198125 3:40753147-40753169 GCCCAATAAATGTTAATTCAGGG + Intergenic
953506788 3:43493585-43493607 ACACAATAAAAAATAATTTAAGG + Intronic
955744718 3:62128823-62128845 GCCACTTAAAAAAAAATTCATGG - Intronic
957941786 3:87015332-87015354 ATACACTAAAAAATTATTCATGG - Intergenic
959599025 3:108158242-108158264 GCCGACTAAATAAAAATTGAGGG + Intergenic
963540450 3:146580877-146580899 ACCCATGAAAAAGTAATTCAGGG - Intronic
963725865 3:148920752-148920774 GTCCTCTAAGGAATAATTCAAGG + Intergenic
964168815 3:153742076-153742098 GTCCAGGGAAAAATAATTCAGGG - Intergenic
964636306 3:158861218-158861240 ACCCACTAAAATATAAATCGAGG + Intergenic
966280332 3:178219164-178219186 GCACATTAAATAATAATACATGG - Intergenic
967139505 3:186542848-186542870 TCCCACTAAAAAAGAATTTTTGG - Intronic
968190256 3:196662041-196662063 GGACACTACAAAATAATCCAAGG - Intronic
969071542 4:4543426-4543448 GCACACTTAAAAATTATTAAGGG - Intergenic
971584632 4:28389369-28389391 GCTGACTAACAAGTAATTCACGG - Intronic
973977598 4:56278801-56278823 GCCCAATAAAAAAAAATTTGGGG - Intronic
974116186 4:57581910-57581932 GCGCACCAAGAAATAAATCAAGG - Intergenic
975409884 4:74038009-74038031 GCCCCCTAAAAATAAAATCAGGG - Intronic
975520716 4:75298284-75298306 GACCAATAAAAAATGATACAGGG + Intergenic
975664640 4:76722861-76722883 GCGCACTAAACAATAATGGATGG + Intronic
976842682 4:89450361-89450383 GCACACTTAAAAATGAGTCATGG + Intergenic
977190784 4:93998313-93998335 GCCCACTTGAAAATAATGAAAGG - Intergenic
977848061 4:101790219-101790241 ACCCAGTAAAAAATTATTTATGG - Intronic
979010203 4:115357130-115357152 GCCTGGTAAAAAATAATTAAAGG - Intergenic
979103769 4:116658510-116658532 ACACACTAAAAAATAATAAAGGG + Intergenic
979837169 4:125385372-125385394 GCACACTAAAATTTAATTTAAGG - Intronic
980507382 4:133740190-133740212 GCCCACTAAACAAAAGTTTAAGG - Intergenic
980578283 4:134713934-134713956 GCGCAATAAAAAATAATAAAGGG + Intergenic
981319642 4:143376366-143376388 CACTACTAAAAAAGAATTCAAGG + Intronic
981668455 4:147257767-147257789 GCGCAATAAAAAATAATAAAGGG + Intergenic
981874104 4:149520084-149520106 GCCCACTAAATAATAATGGTAGG + Intergenic
983503262 4:168524787-168524809 GACCACTAAAGAATCAATCATGG - Intronic
983733277 4:171024543-171024565 GCACAAGAAAAAATAATTTATGG - Intergenic
984512871 4:180699866-180699888 GCTCAAAAAAAATTAATTCAAGG + Intergenic
986965739 5:13268341-13268363 GCCCATTAAAAAATGAGCCAGGG - Intergenic
987381857 5:17292872-17292894 GCCAAATAAAAAATAATTTTTGG + Intergenic
987653801 5:20779308-20779330 GCCCACTAAATCATGATTCAAGG - Intergenic
988741776 5:34082185-34082207 GCCCACTAAATCATGATTCAAGG + Intronic
991283655 5:64944414-64944436 GCCAAGTAAACAATAATTCAAGG - Intronic
991629187 5:68637245-68637267 GACCATTAAAAAATATTTAAAGG + Intergenic
993165245 5:84345359-84345381 ACCCACTATAAACTAATTTAAGG - Intronic
993846564 5:92951823-92951845 GCCCTATAAAAAATACTTAAGGG - Intergenic
994017703 5:94987581-94987603 GCACAAGAAAAAATACTTCATGG + Intronic
994789614 5:104206740-104206762 GCCCACTGAAAAATAAGTGGAGG - Intergenic
994979790 5:106859266-106859288 ACCCACAAACAAATAATTTATGG - Intergenic
995934941 5:117499332-117499354 GCCCATTAAGAAAGAAGTCAAGG - Intergenic
996191803 5:120553224-120553246 GACTACTAAAAAATAAATTAAGG + Intronic
996671429 5:126122246-126122268 TCCCACTGAAAAAAAGTTCAAGG - Intergenic
998573844 5:143291533-143291555 GCTCACTAAAAAATTATTAGAGG - Intronic
999263663 5:150252925-150252947 GCCCACTAAAAAGTACTCCCAGG + Intronic
1000818801 5:165958070-165958092 TCCCATTAAAAAATATTTCCAGG + Intergenic
1001729542 5:173940895-173940917 GGTCAATATAAAATAATTCATGG - Intronic
1003004478 6:2368463-2368485 CCCCACTTAAAAATATTTCTAGG + Intergenic
1004134026 6:12949386-12949408 GCCCAGTAAATAGTAACTCAAGG + Intronic
1006426886 6:33969913-33969935 ACACACGTAAAAATAATTCATGG + Intergenic
1007592339 6:43029956-43029978 GCCCACTAAAAAGTAGTTCTAGG - Intronic
1008190502 6:48451019-48451041 ACCAACAAAAAAAAAATTCAGGG + Intergenic
1009192548 6:60646839-60646861 GGACAGTAAATAATAATTCAAGG - Intergenic
1009993682 6:70876007-70876029 GCCCACTAAAAAATAATTCATGG - Intronic
1010331601 6:74629587-74629609 GCACAATAAAAAATAATAAAGGG + Intergenic
1011902631 6:92319170-92319192 GCAAACAAAAAAATCATTCAGGG - Intergenic
1013644337 6:112121206-112121228 TCCCAGTAAAAATTAATTAATGG + Intronic
1015095862 6:129415290-129415312 GCCCACTGAAAAAAAATCAAAGG - Intronic
1016365342 6:143310377-143310399 GCACACTAATAAATAACCCATGG + Intronic
1017616103 6:156248166-156248188 GCGCTTTAAAAAATCATTCAAGG + Intergenic
1018752381 6:166818708-166818730 CTCGACTAAAAAATAATTGATGG - Intronic
1019007766 6:168816740-168816762 GCCCCCTAAAACATTATTTATGG - Intergenic
1019577051 7:1742617-1742639 GCCCACTCAAAAATGGCTCAGGG - Intronic
1020514853 7:9105749-9105771 GCCCACTGAATAATATTCCATGG - Intergenic
1020753664 7:12173384-12173406 GTCCAGTAAAAAATAAATCAAGG + Intergenic
1022985884 7:35652853-35652875 GCCCTCCAAGAAATAATTAAGGG + Intronic
1024456106 7:49609007-49609029 GCCCATTAAAAAATAGGTAAAGG - Intergenic
1024593982 7:50916924-50916946 CCCCTATAAAAAATAATTTATGG - Intergenic
1026236396 7:68530683-68530705 GCTCACTTTAAAACAATTCAGGG - Intergenic
1027935369 7:84595195-84595217 GCCAACTAAAAAAAAGTTCTGGG + Intergenic
1028607575 7:92671853-92671875 GGCCTTTAAAAAATAATACATGG + Intronic
1028693707 7:93683494-93683516 CTTCACTAAAAAATAACTCATGG - Intronic
1030428006 7:109405030-109405052 GCCCCCTTAAAATTCATTCAAGG + Intergenic
1030855886 7:114556641-114556663 GACCACCAAAAAGTAATTAAAGG + Intronic
1030882819 7:114902237-114902259 ACTCACTGATAAATAATTCATGG + Intergenic
1035902968 8:3477934-3477956 GCTGACTGAAAAATAAGTCAAGG + Intronic
1040365841 8:46714425-46714447 TACCACAAAAAAATGATTCATGG + Intergenic
1041990264 8:63979943-63979965 GCCCACTCAACAATATATCAGGG - Intergenic
1042316306 8:67429977-67429999 GCCCCCTGGAAAATAATTCTTGG - Intronic
1042471296 8:69191459-69191481 GCCAACTAAAAAATAATTGAAGG + Intergenic
1044138877 8:88622700-88622722 GACCACAAAAAAATAATAAAAGG + Intergenic
1045320518 8:101078788-101078810 GCCCATTTAAAATAAATTCAAGG + Intergenic
1046132434 8:109983178-109983200 GCCCTCTTAAAAATTATTGAGGG + Intergenic
1047344297 8:124011906-124011928 AGCCACTAAATAATTATTCAGGG + Intronic
1048039751 8:130715519-130715541 GCGCATTAAAAAAAAATTTAAGG - Intergenic
1048790156 8:138094372-138094394 ACACACTTATAAATAATTCAGGG + Intergenic
1050123405 9:2331742-2331764 GCCCATTAAAAATTAATTGCTGG + Intergenic
1050502359 9:6312501-6312523 TCTCACCAAAAAATACTTCAAGG - Intergenic
1050692608 9:8244770-8244792 GCTCACTGAAAAGCAATTCATGG - Intergenic
1050981788 9:12028277-12028299 GACGACTAAAAAATATTTCAAGG - Intergenic
1051219960 9:14837489-14837511 GCCCACTAAGAATTATTACAGGG + Intronic
1051635631 9:19178570-19178592 GTCCAATTAAAAATACTTCAGGG - Intergenic
1051649317 9:19304847-19304869 GCTCAACAAAAAAAAATTCATGG - Intronic
1052179948 9:25513499-25513521 GCCCAATAAAAAAAATCTCATGG - Intergenic
1052647792 9:31259616-31259638 TCCCACTGAAAAATAATGAAAGG - Intergenic
1057503371 9:95613357-95613379 CCCAACTAATAAATAATTCGTGG - Intergenic
1060162778 9:121381599-121381621 ACCCAAGAAAAAATATTTCAAGG - Intergenic
1060359927 9:122945063-122945085 TCCCACTGAAAAAAAATTCAAGG + Intronic
1061294544 9:129669813-129669835 TCGCAATAAAAAATAATTGAAGG - Intronic
1203460186 Un_GL000220v1:28327-28349 GGCCTCACAAAAATAATTCATGG + Intergenic
1186681626 X:11880941-11880963 ACCCACTAATAATAAATTCAAGG - Intergenic
1190527532 X:51343043-51343065 GCCCACTATACAATATTTTAGGG + Intergenic
1191064565 X:56334017-56334039 ACACAATAAAAAATAATTAAAGG - Intergenic
1191604817 X:63049840-63049862 GCAAACAAAAAAACAATTCAAGG - Intergenic
1191774610 X:64800199-64800221 GCACAATAAAAAATAATAAAGGG - Intergenic
1192729494 X:73788402-73788424 GCACAATAAAAAATAATAAAGGG - Intergenic
1194180628 X:90706919-90706941 GTTCACTGAAAAATATTTCAAGG + Intergenic
1194913897 X:99681354-99681376 CTCCACTCAAAAATAATTAATGG - Intergenic
1196380403 X:115083292-115083314 GCGCAATAAAAAATAATGAAGGG - Intergenic
1198852185 X:140976520-140976542 GCCCACAAAAAGAAAAGTCAAGG + Intergenic
1200527289 Y:4289079-4289101 GTTCACTGAAAAATATTTCAAGG + Intergenic
1201522750 Y:14894143-14894165 GCCTACTAAAAAAGAACTGAAGG + Intergenic