ID: 1009994081

View in Genome Browser
Species Human (GRCh38)
Location 6:70879911-70879933
Sequence CCAACCATGCAGGGCCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 6, 3: 30, 4: 241}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009994081 Original CRISPR CCAACCATGCAGGGCCTGGG AGG Intronic
900229795 1:1550866-1550888 CCCTCCCTGCTGGGCCTGGGAGG + Intronic
900956547 1:5889631-5889653 CCCACCATGCAGAGCCTGCTGGG + Intronic
904367567 1:30024544-30024566 CCAACCATGGGGGACCTGGGTGG - Intergenic
904378290 1:30095308-30095330 CCAATCTTGCAGGGCCTGGGTGG - Intergenic
905108017 1:35575427-35575449 CCTTCCAGGCAGGGCCTTGGAGG + Intronic
905341538 1:37281797-37281819 CAGATTATGCAGGGCCTGGGAGG - Intergenic
905654396 1:39676783-39676805 CCGATCATGCAGGACCTGGAGGG + Intergenic
905931757 1:41792889-41792911 CCATCCCTGCAGGGCCTTGGGGG - Intronic
906051898 1:42881100-42881122 CCAAGCCTGCAGGGGCAGGGGGG + Intergenic
906168445 1:43705201-43705223 GCAATCATGCAGGGGCTGGGAGG + Exonic
909086635 1:71175962-71175984 GCCACCATGCCCGGCCTGGGAGG + Intergenic
909367677 1:74846744-74846766 CCAATGTTGGAGGGCCTGGGAGG - Intergenic
914234445 1:145795412-145795434 CCAATCAAGCAGGACGTGGGCGG - Intronic
918316179 1:183324500-183324522 CAAACCATGCAGGGCCTTCTGGG - Intronic
920534703 1:206729924-206729946 GCAACCCTGCTGGACCTGGGAGG - Intronic
920677490 1:208048322-208048344 CCAACCAGGCAGGGCTTCAGGGG + Intronic
921251292 1:213300888-213300910 CCAACCCAGCAAGCCCTGGGAGG - Intergenic
922324284 1:224513840-224513862 CCAACCACGGAGGGCCTGGGAGG - Intronic
922360804 1:224819659-224819681 CCAGATATGCAGGGCCTGGTAGG - Intergenic
923027777 1:230219614-230219636 CCATCTATGCAGGGCCCAGGAGG - Intronic
923172834 1:231432830-231432852 GCCACCATGCCTGGCCTGGGAGG - Intergenic
924238630 1:242020770-242020792 CCAAGCAGGCAGGGCCAGGTAGG - Intergenic
924577188 1:245291489-245291511 CCAAGCATGCAGGCCTTGTGTGG + Intronic
1063067461 10:2623931-2623953 GCAACCATGCTGGCCCTGTGGGG - Intergenic
1063443184 10:6089573-6089595 GCAACCGTGCAGGGCCAGGGGGG - Exonic
1064717299 10:18190093-18190115 CCACCCATGAAGGGCTTCGGGGG - Intronic
1065261295 10:23926195-23926217 CCACCCATCCCGGCCCTGGGTGG - Intronic
1065971058 10:30806370-30806392 CCAGCCTTGCAGGGCCTCTGTGG + Intergenic
1066433915 10:35379291-35379313 CAAACCATCCAGGTCCAGGGGGG - Intronic
1070284684 10:75074117-75074139 CCAACCATGCTGGGCTTCAGTGG + Intergenic
1070314287 10:75295383-75295405 GCAACCGTCCAGGGCCAGGGAGG + Intergenic
1070745311 10:78930170-78930192 CTCACCAGGCAGGGGCTGGGAGG + Intergenic
1073290516 10:102410991-102411013 CCAGACATGCAGGACCTGGGAGG - Intronic
1076841923 10:133050033-133050055 CCAAGCCAGCAGGGCCAGGGAGG + Intergenic
1077097823 11:806557-806579 CCTTCCATGTAGGGCCTGGAGGG + Intronic
1079241390 11:18724530-18724552 CCAACCAAGTAAGGCCTGGAGGG + Intronic
1080770020 11:35331983-35332005 CCAAGTCTGCAGGGACTGGGAGG + Intronic
1080792625 11:35535452-35535474 CCCATCATGCCAGGCCTGGGTGG - Intergenic
1080826194 11:35851397-35851419 CCAACCATGGAGGGGCTAAGAGG + Intergenic
1083269172 11:61562666-61562688 CAAGCCCTGCAGGTCCTGGGAGG - Intronic
1083278062 11:61608748-61608770 ACCCCCATGCAGGGCTTGGGGGG - Intergenic
1083301565 11:61742355-61742377 CCAAGCACACAGGGCCTGTGTGG - Intronic
1083598828 11:63933662-63933684 GAAACCAGGCAAGGCCTGGGAGG - Intergenic
1083879636 11:65541604-65541626 ACAACCGTGCTGGTCCTGGGTGG + Exonic
1084427769 11:69094893-69094915 CACAACCTGCAGGGCCTGGGAGG - Intergenic
1089151349 11:116366785-116366807 CCAAGCATGCATAGCCAGGGAGG - Intergenic
1089376697 11:117999773-117999795 CCAGCCCTGCAGGGCCTGGCTGG - Exonic
1090329363 11:125918535-125918557 CCATGCATGCAGGGCGGGGGTGG - Intronic
1091175591 11:133554722-133554744 CCAGCACTGCAGGGCCCGGGGGG + Intergenic
1092145960 12:6214858-6214880 TCACGCAGGCAGGGCCTGGGTGG + Intronic
1092215277 12:6677673-6677695 CCAACCATGCAGGGTAAGGCAGG + Intronic
1092447172 12:8568260-8568282 TCAAGCCTGCAGGGACTGGGGGG + Intergenic
1095926404 12:47583850-47583872 CAGACCATGTAGGGCCTTGGGGG + Intergenic
1097806157 12:63967191-63967213 CCCACCTTGCGGGGCCAGGGTGG + Intronic
1102149034 12:110676086-110676108 CCACCCAGGCAGGGCCAGAGCGG + Intronic
1102998092 12:117365019-117365041 CCATCCATGCAGGGGTTGAGGGG - Intronic
1103936833 12:124481476-124481498 CCTGCCATGCAGGCCCTGGAGGG + Intronic
1104711423 12:130989576-130989598 CCAGCCAGGCCGGGCCTCGGTGG + Intronic
1108154742 13:47573695-47573717 ACAGTCCTGCAGGGCCTGGGAGG - Intergenic
1112209828 13:97364726-97364748 CACACCATGCATGGCCTTGGAGG + Intronic
1112468989 13:99670959-99670981 CCAGCAATGCAGGGCTTTGGTGG - Intronic
1113807909 13:113120742-113120764 CTAACCATGCTGGGCTTGGCGGG - Intergenic
1113991502 14:16030787-16030809 CCAGGCGTGCAGGGCCTGTGGGG + Intergenic
1114208936 14:20599381-20599403 CCATCTATGCAAGGCCTGGTAGG - Intronic
1114620000 14:24089993-24090015 CAGATCATGCAGAGCCTGGGAGG + Intronic
1116617180 14:47154512-47154534 CCAAGCATGCAGGGGCAGGGGGG - Intronic
1119848401 14:77847688-77847710 CCAACAAGGCAGGGCCAGGAAGG - Intronic
1119856060 14:77901834-77901856 CCAACAGTGCAGGGCTTGGAGGG + Intronic
1121202307 14:92128529-92128551 CCAATCATGCAGGGCCGGCGGGG - Intronic
1122307978 14:100777434-100777456 CCCAGCAAGCAGGGCCTGGAAGG + Intergenic
1122871419 14:104640707-104640729 CCATCCATGCTGGGGATGGGGGG - Intergenic
1122915356 14:104855848-104855870 CCAACCCTCCAGGGCCTGGCTGG - Intergenic
1123034893 14:105467949-105467971 CCAGCCATGCAGTGCTTGTGAGG + Intronic
1202853965 14_GL000225v1_random:38153-38175 GCCACCATGGAGGGCCTGGCGGG + Intergenic
1124112876 15:26808308-26808330 CCACACAGCCAGGGCCTGGGAGG + Intronic
1125714967 15:41814438-41814460 CCAAACCTGCAGGTCCAGGGAGG + Intronic
1125897786 15:43317026-43317048 GCCACCATGCCTGGCCTGGGAGG - Intergenic
1127770158 15:62224357-62224379 CCCACCAGGCAGGGCAGGGGAGG - Intergenic
1127981110 15:64035838-64035860 CAAAATATGCAGGGCCAGGGAGG + Intronic
1129672931 15:77617086-77617108 GAAGCCATGCAGGGCTTGGGAGG + Intronic
1130109374 15:80952148-80952170 CCAGCCAAACAGGGCCTGGGAGG - Intronic
1130648396 15:85748208-85748230 ACAGCCAGGCAGGCCCTGGGAGG + Intronic
1132659211 16:1054091-1054113 CCGCCCATCCAGGGCCTAGGTGG - Intergenic
1132871880 16:2118957-2118979 CCAACCAAGCCGGCACTGGGGGG + Intronic
1133279289 16:4655965-4655987 CCAACCATGCTGGGCTCTGGCGG + Intronic
1134520647 16:14917939-14917961 CCAACCAAGCCGGCACTGGGGGG - Intronic
1134550928 16:15138035-15138057 CCAACCAAGCCGGCACTGGGGGG + Intronic
1134708319 16:16316590-16316612 CCAACCAAGCCGGCACTGGGGGG - Intergenic
1134715534 16:16356623-16356645 CCAACCAAGCCGGCACTGGGGGG - Intergenic
1134951283 16:18352055-18352077 CCAACCAAGCCGGCACTGGGGGG + Intergenic
1134959223 16:18395536-18395558 CCAACCAAGCCGGCACTGGGGGG + Intergenic
1136049497 16:27640373-27640395 GGAGCCATGCACGGCCTGGGGGG + Intronic
1136910755 16:34142491-34142513 CCAGGCATGCAGGGCGTGTGGGG - Intergenic
1137274994 16:46927515-46927537 CCATCCATGCAGGGCCAGAACGG - Intronic
1139486183 16:67257780-67257802 CAAACCATGCAGGGCCAAGCAGG - Intronic
1141534574 16:84670225-84670247 ACAGCCAAGCAGGGCCTGAGTGG + Intergenic
1141610542 16:85178729-85178751 GCAACCAGGCAGGGTCTTGGGGG + Intronic
1142024952 16:87807382-87807404 CCAGCCATGCAGGGCCTGGAAGG + Intergenic
1142491548 17:283132-283154 CCACCCACGCAGGGACCGGGTGG - Intronic
1142672206 17:1492411-1492433 ACAAGCTTGCAGGGCCTGTGGGG + Exonic
1143618558 17:8068017-8068039 TCAGCCAGGCAGGGCCTCGGTGG + Intergenic
1147836194 17:43333699-43333721 CCAACCCTACAGGGCCTTTGGGG + Intergenic
1147881977 17:43660185-43660207 GCAACCAGGGAGGGCCTGGTGGG + Intronic
1148846776 17:50534248-50534270 ACACCCCTGCAGGGGCTGGGGGG - Intronic
1149517011 17:57288394-57288416 CTAACCTTTCAGGGCCTGGAAGG - Intronic
1151354182 17:73548773-73548795 CCCACCATGCAGAGCCTGGTTGG - Intronic
1151946148 17:77321024-77321046 CCAAGGAGGCTGGGCCTGGGAGG - Intronic
1152408519 17:80110668-80110690 GCTTCCATGCAGGCCCTGGGTGG + Intergenic
1152861418 17:82698615-82698637 CCACCCATGCCCGGCCTGCGGGG + Exonic
1153428064 18:4987948-4987970 CCAACCCTGCAGGGTCAGGGGGG + Intergenic
1155037786 18:22039788-22039810 CCATCAATGGAAGGCCTGGGAGG - Intergenic
1155289371 18:24325302-24325324 CCAGGCCTGCAGGGCCTGGTTGG - Intronic
1156041804 18:32831329-32831351 TCAAGCATGCAGTGCATGGGGGG + Intergenic
1156350897 18:36300073-36300095 CCATGCATTCAGAGCCTGGGTGG - Intronic
1157329531 18:46693220-46693242 AGAACTATGCAGGCCCTGGGGGG - Intronic
1160364516 18:78312958-78312980 CCAACCCTGCCAGCCCTGGGTGG - Intergenic
1160535368 18:79588769-79588791 CCCTCCGTGCAGGGGCTGGGAGG - Intergenic
1160793205 19:932529-932551 CCAAGCTGGCAGGGCCTGGGGGG - Exonic
1160812445 19:1018697-1018719 GCCACCATGCCTGGCCTGGGTGG - Intronic
1161166227 19:2789272-2789294 CTAACCGTGCAGGGCCCAGGGGG - Intronic
1161195289 19:2983122-2983144 GCAACTTAGCAGGGCCTGGGAGG + Intronic
1161493713 19:4576277-4576299 CCAGTCATGCAGGGCCTCGTGGG - Intergenic
1161546882 19:4886432-4886454 TCAGCCATGCAGGGCCTTGCAGG + Intergenic
1161547202 19:4888666-4888688 TCAGCCATGCAGGGCCTTGCAGG + Intergenic
1162521121 19:11180141-11180163 GAAACCATGCATGGGCTGGGCGG - Intronic
1162925284 19:13927885-13927907 GCGACCATCCAGGACCTGGGTGG - Exonic
1164051453 19:21587903-21587925 GCACTCATGCAGGGCCTCGGAGG - Intergenic
1164616030 19:29667227-29667249 CCAGCAGGGCAGGGCCTGGGAGG - Intronic
1164682527 19:30145165-30145187 CAAAGCAGGCAGGGACTGGGCGG + Intergenic
1165010314 19:32841323-32841345 CCAGCCATGCAGGGAGTGAGAGG + Intronic
1166050408 19:40255750-40255772 CCAGCCAGGCAGGGCTTTGGAGG + Intronic
1167455305 19:49594628-49594650 CCGGCCCTGCAGGGCCAGGGTGG + Intronic
1167745877 19:51351620-51351642 CCAAAAAGGCAGGGCCTGGGTGG - Intronic
1167949763 19:53016705-53016727 GCCACCATGCCTGGCCTGGGAGG - Intergenic
1168274777 19:55271610-55271632 CCAGCCATGCAGAGGCTGGGAGG - Intronic
926167621 2:10531298-10531320 CCCACCATACCTGGCCTGGGAGG - Intergenic
927852881 2:26510968-26510990 CCCACAGTGCTGGGCCTGGGTGG + Intronic
927899710 2:26810610-26810632 CCAACCAGACAGAGCATGGGGGG + Intergenic
928573323 2:32629404-32629426 GCCACCATGCACGGCCTAGGCGG + Intronic
929557076 2:42932206-42932228 TCAAGCATCCAGGCCCTGGGAGG + Intergenic
930015607 2:46968451-46968473 CCAAGCCTGCAGCACCTGGGTGG + Intronic
932340485 2:70960165-70960187 CCAAGCAGGCAGGGGCTGGCAGG + Intronic
933893645 2:86791648-86791670 CCAGCAATGCAGGCCATGGGAGG - Intronic
935410336 2:102755534-102755556 CATACCATGCTGTGCCTGGGTGG - Intronic
935782701 2:106521900-106521922 CCAACCATGGAGTGTCTGGGTGG + Intergenic
936069036 2:109353272-109353294 GCAGCCATGCAGGCCCAGGGAGG - Intronic
937167701 2:119836682-119836704 CCAAGCCTGCAGGGGCTGAGGGG - Intronic
937206342 2:120239293-120239315 CCAGCCATGCCGGGCTGGGGAGG + Intergenic
940327904 2:152444329-152444351 CCACCCATGCAGGGTCTGGGCGG - Intronic
942328118 2:174792672-174792694 CCAACCCAGCAGGGTCTGGCAGG + Intergenic
945058409 2:205887938-205887960 GAAGGCATGCAGGGCCTGGGAGG + Intergenic
947716125 2:232339687-232339709 CTGAGCATGCAGGGCCGGGGTGG + Intronic
948706020 2:239792918-239792940 GTGACCCTGCAGGGCCTGGGTGG - Intronic
948828879 2:240587730-240587752 ACAACACTGAAGGGCCTGGGAGG + Intronic
948869831 2:240792329-240792351 CCAGCCCAGCAGGCCCTGGGAGG - Intronic
1169000270 20:2163349-2163371 CCAACAAAGCAGGGACTGGAGGG - Intronic
1169192568 20:3667437-3667459 CCCACCATGCAGGGCCACAGTGG - Intergenic
1170119572 20:12896812-12896834 GCAACCATGCAGGCCATTGGAGG - Intergenic
1171107937 20:22453593-22453615 TCAACAATGCAGGGGGTGGGTGG - Intergenic
1172268742 20:33640172-33640194 CCATCCATGCAGGTGCTGGCTGG - Intronic
1172870538 20:38132786-38132808 CCAAACATCGAGGACCTGGGAGG - Intronic
1174521985 20:51138794-51138816 CCAACTTTTCAGGGCCTTGGGGG - Intergenic
1174774477 20:53331482-53331504 CCAACCATGCACGACCTCTGAGG + Intronic
1175467943 20:59205267-59205289 CAAATCCTGCAGGGCCTGGGTGG - Intronic
1175975280 20:62707791-62707813 CAAAGCCTGCAGGGCCTGGGAGG + Intergenic
1176136272 20:63523372-63523394 CCCACCACACATGGCCTGGGGGG + Intergenic
1176248915 20:64110807-64110829 CCAGCCAGGCAGGCCCTGGTAGG + Intergenic
1176270111 20:64231923-64231945 CCAGTCATGCAGGGGCTGTGAGG + Intronic
1177037509 21:16061294-16061316 CCAAGCCTGCAGGGGCAGGGGGG + Intergenic
1180212362 21:46302433-46302455 CCAAGGAAACAGGGCCTGGGTGG - Intronic
1180315768 22:11276737-11276759 CCAGGCGTGCAGGGCCTGTGGGG - Intergenic
1181064017 22:20297168-20297190 CCCAACATACAGGGCCTGGGTGG + Intergenic
1181275679 22:21686363-21686385 GGCACCAAGCAGGGCCTGGGGGG + Intronic
1181830265 22:25555008-25555030 CAGACCCTGCAGGGCCTTGGAGG - Intergenic
1182109911 22:27715640-27715662 GCAGCCATTGAGGGCCTGGGAGG + Intergenic
1183539883 22:38423761-38423783 CCAGCCCTGCAGGCCCTGGGTGG - Intergenic
1183974276 22:41501695-41501717 ACAACCATGCAGTGCATGAGTGG + Intronic
1183978058 22:41524601-41524623 CCATCCCTGCAGGGCCGGGCCGG - Intronic
1185276907 22:49953787-49953809 TCAAGCAGGAAGGGCCTGGGAGG + Intergenic
950114123 3:10439379-10439401 CCACCCATGCTGGGCAGGGGCGG - Intronic
950430783 3:12949747-12949769 ACAGCCAGGCAGGGTCTGGGGGG + Intronic
951521106 3:23611527-23611549 CCCAGCCTCCAGGGCCTGGGCGG + Intergenic
953709726 3:45259966-45259988 CCAGGCATGGAGGGCCGGGGAGG - Intergenic
953901825 3:46847844-46847866 CCAACCCGGCAGAGGCTGGGAGG + Intergenic
954146314 3:48635965-48635987 CCAACCATTTCTGGCCTGGGTGG - Intergenic
955466997 3:59247744-59247766 AGAACCAGGCAGGGCCAGGGTGG + Intergenic
961237009 3:125375526-125375548 CCCCCCAGGCTGGGCCTGGGAGG + Intergenic
961554054 3:127685548-127685570 CCACCCACCCAGGGCCTGAGTGG + Intergenic
961554056 3:127685552-127685574 CAAACCACTCAGGCCCTGGGTGG - Intergenic
961825240 3:129595798-129595820 CCAAACAGGCATGGCCTGGAAGG + Intronic
961832754 3:129632597-129632619 CCATCCATTGAGGGACTGGGAGG + Intergenic
962206884 3:133442045-133442067 ACAAGCATGCAGGGCCTTGAAGG + Intronic
962353398 3:134672979-134673001 CCACCCATGCAGGGCCTTACAGG - Intronic
965087153 3:164113806-164113828 CCAAGCCTGCAGGGGCAGGGGGG - Intergenic
968138122 3:196233823-196233845 CCAACCACGCGGGGCCCTGGTGG + Intronic
972397954 4:38673268-38673290 CCCACCCTGCAGGGAGTGGGAGG - Intronic
973341838 4:49013214-49013236 CCAACCAGGCTGCGCCTTGGAGG + Intronic
976491478 4:85675676-85675698 CCAACCATGTAAGGGCTTGGCGG + Intronic
978138298 4:105289665-105289687 CCAGCCATGATGGGCATGGGTGG + Intergenic
981523830 4:145692827-145692849 CTAAGCAAGCAGGGACTGGGTGG - Intronic
982281207 4:153684725-153684747 CCAACCTTGCAGGCCCCGGGGGG + Intergenic
984045457 4:174792292-174792314 CCAACAAGGGAGGGCCTCGGAGG - Intronic
984642106 4:182178064-182178086 CCAATCCTGCAGGGGCTAGGGGG - Intronic
985586952 5:745424-745446 CCCACCATGCAGGCCCTGTGAGG + Intronic
985601524 5:837606-837628 CCCACCATGCAGGCCCTGTGAGG + Intronic
986748619 5:10765221-10765243 CCCATCATGCAGGGTCTGGTAGG - Intergenic
987860734 5:23484891-23484913 ACCACCATGCATGGCCTGGGTGG - Intergenic
990504106 5:56427679-56427701 TCAACCATGTAGGGCCTTGGAGG - Intergenic
991728210 5:69558494-69558516 CCAACCCTGCAGGGCTTAGTGGG - Intergenic
991804639 5:70413641-70413663 CCAACCCTGCAGGGCTTAGTGGG - Intergenic
991866745 5:71069381-71069403 CCAACCCTGCAGGGCTTAGTGGG + Intergenic
997367544 5:133335544-133335566 CCAACCATGCAAGGCCTGGAGGG - Intronic
1002280538 5:178127495-178127517 CCAAGCATGAGGAGCCTGGGTGG - Intergenic
1002911971 6:1497533-1497555 CCAGCCAGGCAGGGCCAGGGTGG + Intergenic
1003473666 6:6461574-6461596 GCAACCATGCAGAGCCTGGGAGG + Intergenic
1003497773 6:6679178-6679200 CCAACCAGGCAGGGACAGGATGG + Intergenic
1007252162 6:40503115-40503137 CCAGCCATGCAGGGCCACGAGGG + Intronic
1007683178 6:43648547-43648569 ACAATCATGCAGGGCCTTGTGGG + Intronic
1009455930 6:63856108-63856130 CCAACCAAGCAGAGCCTGATAGG + Intronic
1009501966 6:64425170-64425192 ACAACCATGCAGGGTCTTGTTGG + Intronic
1009994081 6:70879911-70879933 CCAACCATGCAGGGCCTGGGAGG + Intronic
1013702529 6:112790611-112790633 CAAACCATGAAGGGCCTTGAAGG - Intergenic
1015228636 6:130887519-130887541 CAGATCATGCAGGGCCTTGGAGG - Intronic
1015303450 6:131679974-131679996 CCAATCCTGCAGGGCCTTGCAGG + Intronic
1017747860 6:157462779-157462801 CCAGCCCTGGAGGGCCTGGCGGG + Intronic
1018387731 6:163320143-163320165 CCAAACATCCAGGGCCCGGAAGG + Intergenic
1018609836 6:165637386-165637408 ACACCTAGGCAGGGCCTGGGTGG - Intronic
1019367898 7:644677-644699 TCAACCCACCAGGGCCTGGGTGG + Intronic
1024230723 7:47361295-47361317 CCCACCATGGAGGGCCAGGATGG - Intronic
1025029647 7:55546827-55546849 CAGGCCATGCAGAGCCTGGGAGG + Intronic
1025149967 7:56540125-56540147 CCAACCATGCCCTGCCTGAGAGG - Intergenic
1026863873 7:73810891-73810913 CCACCCCACCAGGGCCTGGGAGG - Intronic
1028510578 7:91621008-91621030 CAGAGCATGGAGGGCCTGGGAGG - Intergenic
1028984829 7:97001671-97001693 CAAACCAGGCAGGACCTGGATGG - Intergenic
1029270426 7:99374244-99374266 CCAACTGTGCAGGCCCTGGGCGG - Intronic
1029986957 7:104931252-104931274 CAAAACAATCAGGGCCTGGGTGG - Intergenic
1030296359 7:107932435-107932457 ACAGCTGTGCAGGGCCTGGGTGG + Intronic
1032484798 7:132277381-132277403 ACCACCATGCAGGTCCTGTGAGG + Intronic
1034940045 7:155224791-155224813 CCATCCAGGGAGGGGCTGGGAGG + Intergenic
1035070679 7:156143276-156143298 CCGAGCATGCTGGGCCTGGCCGG + Intergenic
1035456379 7:159011638-159011660 TTAACCCTGCATGGCCTGGGAGG + Intergenic
1035734259 8:1876370-1876392 CCACCCGGGCAGGGCCGGGGAGG - Intronic
1035920098 8:3667473-3667495 CAAACAATGCAGGGCCAGGGTGG + Intronic
1036621083 8:10424825-10424847 CCAAGCCTGCAGGGCCCTGGAGG + Intronic
1036987682 8:13554893-13554915 CCAATCATGTAGGGCCTTGCAGG - Intergenic
1037330140 8:17736289-17736311 CCAACCAAGCAGGGCCATGCAGG - Intronic
1038429090 8:27485537-27485559 TTAGCCAAGCAGGGCCTGGGTGG - Intergenic
1038963457 8:32547942-32547964 GCAGCCAGGCAGCGCCTGGGAGG - Intronic
1041389019 8:57332631-57332653 CCGGCCATGCAGGGGCTGAGAGG - Intergenic
1041743982 8:61186122-61186144 CCAACACTGCATGGCCTGTGGGG + Intronic
1043988679 8:86724939-86724961 CAGACCAGGCAGGGCCTGAGAGG + Intronic
1045240440 8:100396025-100396047 CCAACCGTGCTCAGCCTGGGTGG - Intronic
1047370786 8:124254107-124254129 CCAGCCATGCAGGGTCTTGGAGG + Intergenic
1047741458 8:127810121-127810143 TCAGGCATGCTGGGCCTGGGGGG + Intergenic
1048693147 8:136989895-136989917 CCCAACTTGCAGGGCCAGGGAGG + Intergenic
1048875704 8:138835587-138835609 CCAGCCCTGCAGGTCCTGAGGGG - Intronic
1049211559 8:141388987-141389009 CCAGCCACGGAGGGCATGGGTGG - Intergenic
1049393296 8:142382962-142382984 CCAGCCGAGCAGGGTCTGGGGGG + Intronic
1049767843 8:144363207-144363229 CCCACCACGCAGGGCCTGCTGGG + Intergenic
1052786179 9:32830695-32830717 CAGACCCTGCATGGCCTGGGTGG - Intergenic
1056578845 9:87876011-87876033 CCACCCAGGCAGGACCTGGACGG + Intergenic
1057845367 9:98518588-98518610 CCGAGAAAGCAGGGCCTGGGAGG - Intronic
1060591704 9:124820958-124820980 CCAAGCAGCCAGGGCCGGGGAGG - Intergenic
1061212471 9:129201871-129201893 CTAACCATGCAGGGCTGGGTGGG + Intergenic
1061760643 9:132848763-132848785 AAAACCATGCAGGGCCTGCAGGG + Intronic
1061885155 9:133587632-133587654 CCCACCAGGCAGGGTGTGGGAGG + Intergenic
1062005600 9:134237086-134237108 CCAACCCTGCAGGGCAAGGGCGG + Intergenic
1062103489 9:134740276-134740298 CCAGCCATGCCGGTCCTGGCTGG - Intronic
1062443876 9:136585366-136585388 CCTCCCATGCAGGGTCTTGGGGG - Intergenic
1187268946 X:17762433-17762455 CCAACCATCCCGGGACTGCGGGG - Intergenic
1187285479 X:17899599-17899621 GCAACTGTGCAGGGCCTGGAGGG + Intergenic
1190740278 X:53284040-53284062 CCCAGCATGCAGAGCCTTGGAGG + Intronic
1193940213 X:87673257-87673279 CCAACCCTGTTGGGCCTGGAGGG - Intergenic
1195454334 X:105051273-105051295 CCGAGCCTGCAGGGACTGGGGGG + Intronic
1196873468 X:120135565-120135587 CACACCATGCAGGGGCTGGAAGG - Intergenic
1196930134 X:120673835-120673857 CATACCATGCAAGGCCTTGGAGG + Intergenic
1197700301 X:129594684-129594706 CCATTGATGCAGGGCCTGGTGGG - Intergenic
1198370299 X:135983343-135983365 CCATCCATGCAGTGACTGAGAGG + Intergenic