ID: 1009995575

View in Genome Browser
Species Human (GRCh38)
Location 6:70891776-70891798
Sequence GTGTGTGTGTACATGTAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 970
Summary {0: 1, 1: 0, 2: 11, 3: 123, 4: 835}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1009995574_1009995575 19 Left 1009995574 6:70891734-70891756 CCTCAGAGCTCAGATTGTGTGTG 0: 1
1: 0
2: 1
3: 17
4: 237
Right 1009995575 6:70891776-70891798 GTGTGTGTGTACATGTAACTTGG 0: 1
1: 0
2: 11
3: 123
4: 835

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1009995575 Original CRISPR GTGTGTGTGTACATGTAACT TGG Intronic
900150526 1:1177162-1177184 GTGTGTGTGTGCATGTCTGTAGG + Intronic
900293776 1:1938304-1938326 GTGTGTGAGTGCATGTATGTGGG - Intronic
901715059 1:11146783-11146805 GTGTGTGTGTATAGGTCAGTGGG - Exonic
901804612 1:11730303-11730325 GTGTGTGTGTGCATGTGTGTAGG - Intergenic
901804619 1:11730365-11730387 GTGTGTGTGTGCATGTGTGTAGG - Intergenic
902034971 1:13451188-13451210 GTGTGTGTGTACAGAAAAATTGG + Intergenic
902373066 1:16017400-16017422 GTGTGTGTGTATATGAGGCTAGG + Intronic
902620231 1:17646551-17646573 GTGTGTGTGCACATGGAGGTAGG - Intronic
902701802 1:18177427-18177449 GTGTGTGTGTACATGGTTCTTGG + Intronic
902754883 1:18542408-18542430 GTGTGTGTGTAAATGTGGATGGG - Intergenic
903223563 1:21882388-21882410 GTGTGTGTGTACATAGAAGAGGG - Intronic
903381743 1:22901831-22901853 GTGTGTGTGTGTGTGTAACAGGG + Intronic
904217750 1:28936910-28936932 GTTTTTGTGGATATGTAACTAGG + Intronic
904245650 1:29185977-29185999 GTGTGTGTGTGCATGTGATGGGG - Intergenic
904451797 1:30617977-30617999 GTGTGTGTGTACATCTTAAAAGG + Intergenic
904453808 1:30634558-30634580 GTGTGTGTGTGCATGCACATGGG + Intergenic
904873105 1:33634151-33634173 GAGTGTGTGTACATGTACATAGG + Intronic
904991683 1:34598357-34598379 GTGTGTGTGTGTATGTATTTTGG - Intergenic
905037707 1:34928922-34928944 GAGTGTGTGTGCATGTTAGTGGG - Intronic
905174360 1:36126518-36126540 GTCTGTGTGTGCATGTAGGTGGG + Intergenic
905174366 1:36126580-36126602 CTGTGTGTGTACGTGTAGGTGGG + Intergenic
905246103 1:36614948-36614970 GTGTGTGTGTATATGTATGTAGG + Intergenic
905480188 1:38256443-38256465 GTGCGTGTGTGCATGTGACATGG - Intergenic
906457961 1:46013847-46013869 GTGTGTGTGTATATGTGTGTTGG + Intronic
906554794 1:46701001-46701023 GTGTGTGTGTGCATGTGAGATGG + Intronic
907062216 1:51440303-51440325 GTGTGTGTGTGTATGTGAGTAGG + Intronic
907154245 1:52318400-52318422 GTGTGTGTGTGTGTGTATCTTGG + Intronic
907664569 1:56423556-56423578 GTGTGTGTGTGTGTGTACCTTGG - Intergenic
907800687 1:57762295-57762317 GTGTGTGTGTATACGTATATGGG + Intronic
908609417 1:65840185-65840207 GTGTGTGTGTACGTATAAAATGG + Intronic
908787666 1:67751160-67751182 GTATGTGTATCCATGTAAATGGG - Intronic
909337644 1:74494156-74494178 GTGAGTGTGCATGTGTAACTGGG - Intronic
909506664 1:76398679-76398701 ATGTTTGTGTACATGAAAATTGG + Intronic
909651476 1:77980359-77980381 GTGTGTGTGTGTGTGTAAATTGG + Intronic
909997275 1:82295892-82295914 GTGTGTGTGTACATTTATTATGG - Intergenic
910040591 1:82846848-82846870 GTGTGTGTGTGTGTGTAAATTGG - Intergenic
910582986 1:88848636-88848658 GTGTGTGTGTGTGTGTATCTGGG + Intergenic
910713609 1:90206694-90206716 GTGTGTGTGTATGTGTTACATGG - Intergenic
911173804 1:94798095-94798117 GTGTGTGTGTGTGTGTAAGTGGG + Intergenic
911232403 1:95374797-95374819 GTATGTGTGTATGTGTGACTGGG + Intergenic
911351454 1:96761374-96761396 GTGTGTGTGTGTGTGTAGCTTGG + Intronic
911688158 1:100800941-100800963 GTGTGTGTGTGTGTGTAACTTGG - Intergenic
911950181 1:104163564-104163586 GTGTGTGTGTATATATATATGGG - Intergenic
911987673 1:104650588-104650610 GTGTGTGTGTGTATGCATCTGGG + Intergenic
912244766 1:107949723-107949745 CTGTGTGTGTACATGTACTTTGG - Intronic
912336094 1:108864473-108864495 GTGTGTGTGTGTGTGTAACCTGG - Intronic
912649831 1:111427797-111427819 GTGTGTGTGTATGTGTAGCTGGG - Intergenic
912942100 1:114054128-114054150 GTGTGTATGTACATGTATGTAGG + Intergenic
913536308 1:119775713-119775735 GTGTGTGAGTTCATGTTCCTTGG - Intergenic
913670076 1:121088987-121089009 GTGTGTGTGTCGATTTATCTGGG + Intronic
913936940 1:125064388-125064410 GTGTGTGTCTGCATGTGTCTGGG - Intergenic
914021841 1:143876383-143876405 GTGTGTGTGTCGATTTATCTGGG + Intergenic
914660327 1:149784334-149784356 GTGTGTGTGTCGATTTATCTGGG + Intronic
914972423 1:152321051-152321073 GTGTGTGTGTATATATATATAGG - Intronic
915209093 1:154293495-154293517 GTGTGTGTGTGTGTGTAATTTGG - Intergenic
915293490 1:154902556-154902578 GTGTGTGTGTGCATGTGTGTGGG - Intergenic
915389894 1:155532941-155532963 GTGTGTGTGTATATATATATGGG + Intronic
915465469 1:156095252-156095274 GTTTGTGTGTTCATGTTACTCGG + Intronic
915527045 1:156482354-156482376 GTCTGCGTGTACATGCAACGTGG + Intronic
915967079 1:160319143-160319165 GTGTGTCTGTATAGGTAAATGGG - Intronic
916809538 1:168293317-168293339 GTGTGTGTGTAACTGTCACCTGG + Intronic
917000062 1:170347860-170347882 GTGTGTGTGTGCATGTGTTTTGG + Intergenic
917728376 1:177849308-177849330 GTGTGTGTGTATGTGTGACTTGG - Intergenic
917958010 1:180120021-180120043 GTGTGTGTGCACATGTAAATTGG - Intergenic
918083238 1:181223419-181223441 GTGTGTGTGTATGTGTATGTGGG + Intergenic
918135099 1:181665144-181665166 GTGTGTGTGTATAGGTATATAGG - Intronic
918393567 1:184091566-184091588 GTAGGTGTGTACATATAACATGG + Intergenic
918559404 1:185846522-185846544 GTTTGACTGTACATATAACTTGG + Intronic
918770810 1:188557407-188557429 GTGTGTGTGTGCATGTGAGTTGG + Intergenic
918979586 1:191538397-191538419 GTGTGTGTGTGTGTGTATCTGGG + Intergenic
919314375 1:195952851-195952873 GTGTGTGTGGACATGGAATATGG - Intergenic
919496664 1:198280368-198280390 GTGTGTGTGTAATTGTAGCCTGG - Intronic
919499549 1:198319060-198319082 GTGTGTATTTACAGTTAACTTGG + Intronic
920447598 1:206030886-206030908 GTGTGTCTGTACCTGTAAGCAGG + Intergenic
920752006 1:208687282-208687304 TTGTGTGTGTATGTGTTACTCGG + Intergenic
921156686 1:212444553-212444575 GTGTGTGTGTGTGTGTATCTGGG + Intronic
921174981 1:212585802-212585824 GTGTGTGTATGCATGTAATGAGG + Intronic
921445377 1:215240415-215240437 GTGTGTGTGTGCATGTGTGTGGG + Intergenic
921639151 1:217531032-217531054 GTGTGTGTGTTTGTGTAACTGGG - Intronic
921715602 1:218414214-218414236 GTGTGTGTGCACATGTGTTTAGG - Intronic
921973126 1:221172857-221172879 GTGTGTGTGTGTGTGTATCTGGG + Intergenic
922996991 1:229972016-229972038 GAGTGTATGTACATGTGAGTGGG - Intergenic
923377946 1:233384655-233384677 GTATGTGTGTGCATGTATGTTGG + Exonic
923613217 1:235513688-235513710 GTGTGTGTGTGCATTTAGATGGG + Intergenic
923638832 1:235730499-235730521 GTGTGTGTATACATATATATGGG + Intronic
924014583 1:239706755-239706777 GTGTGTGAGTACATGCACATGGG - Intronic
924589477 1:245389426-245389448 GAGTGTGTGTACATGGAAAATGG - Intronic
924621180 1:245662322-245662344 GTGTGTGTGTATATATCATTAGG - Intronic
924621183 1:245662361-245662383 GTGTGTGTGTATATATCACTGGG - Intronic
924621192 1:245662461-245662483 GTGTGTGTATATATGTATCATGG - Intronic
924621209 1:245662625-245662647 GTGTGTGTGTATATATCACTGGG - Intronic
1063027313 10:2193212-2193234 GTGAGTGTGTATATGTAATAAGG + Intergenic
1063059272 10:2534317-2534339 GTGTGTGTGTGTGTGTAAATTGG + Intergenic
1063374299 10:5544835-5544857 GTGTGTGTGCACATGTACGTGGG - Intergenic
1063859688 10:10294091-10294113 GTGTGTGTCTATATGTAAGTAGG + Intergenic
1063859706 10:10294496-10294518 GTGTGTGTGTGTATGTAGCAGGG + Intergenic
1064128264 10:12683768-12683790 GTGTGTGTGTGTGTGTAACATGG + Intronic
1065033988 10:21619019-21619041 GTGTGTGTGTGTATGTCACCAGG - Intronic
1065178875 10:23105236-23105258 GTGTGTGTATACAAGTTTCTGGG + Intronic
1065921456 10:30396939-30396961 GTTTGTGTGTACATGTGGATGGG - Intergenic
1066036151 10:31487392-31487414 GTGTGTGTTTACATTTATTTAGG + Intronic
1066094991 10:32063936-32063958 GTGTGTGTGTGTGTGTAATTAGG + Intergenic
1066206098 10:33190796-33190818 GTGTGTGTGTGCATGTGTGTTGG + Intronic
1067207401 10:44231372-44231394 GTGTGTCTTTGCATGTAAGTGGG + Intergenic
1067442556 10:46317706-46317728 GTGTGTGTGTGCATGTGTTTTGG - Intronic
1067708032 10:48625681-48625703 GTGTGTGTGTACACGTTGCAGGG - Intronic
1067726118 10:48772405-48772427 GTGTGCGTGTGTATGTAAGTAGG + Intronic
1067726123 10:48772438-48772460 GTGTGTGTGTATGTGTATTTGGG + Intronic
1068433645 10:56963544-56963566 GTGTGTGTAGACATGGAGCTGGG - Intergenic
1068604332 10:58988945-58988967 GTGTGTGTGTATGTGTAAGCTGG + Intergenic
1068706255 10:60079168-60079190 GTGTGTGTGTGTGTGTAGCTAGG - Intronic
1068866636 10:61902075-61902097 GTCTGTGTGTAAATGTGTCTGGG + Intronic
1068903340 10:62294977-62294999 GTGTGTGTGTATATATATATAGG + Intergenic
1069083593 10:64114489-64114511 GTGTGTGTGTATAAGTAAGTGGG + Intergenic
1069189782 10:65472111-65472133 GTGTGTGTGTGTGTGTATCTGGG + Intergenic
1069191804 10:65501152-65501174 GTATGTGTGTACATATATGTAGG - Intergenic
1069648676 10:70025661-70025683 GTGTGTGTGTACACACAACATGG + Intergenic
1069718061 10:70533389-70533411 GTGTGTGTGTACCTGTATGTAGG + Intronic
1070361331 10:75692597-75692619 GTGTGTGTGTATGTGTATGTAGG + Intronic
1070375194 10:75823747-75823769 GTGTGTGTGTGTATGTAAGTAGG - Intronic
1070573021 10:77655774-77655796 GTGTGTGTGTATGTGCAAATAGG - Intergenic
1071071515 10:81699156-81699178 GTGTGTCTTTGCATGTAAGTTGG - Intergenic
1071127486 10:82352184-82352206 GTGTGTTTGTGCATGTATGTGGG - Intronic
1071208933 10:83315755-83315777 GTGTGTGTATACATATACCACGG - Intergenic
1071271548 10:84012053-84012075 GTGTGTGTGTGTATTTAAGTAGG - Intergenic
1071717412 10:88111268-88111290 GTGTGTGTGTACCTGTGTCAGGG + Intergenic
1072042883 10:91626270-91626292 GTGTGTGTGTGTGTGTAAGTGGG + Intergenic
1072142613 10:92602795-92602817 GTGTGTGTGTTTAAGTAACCAGG - Intronic
1072199547 10:93145834-93145856 GTGTGTGTGTGTGTGTTACTTGG - Intergenic
1072785974 10:98282546-98282568 CTGTGTGTGTACATGTGTGTTGG + Intergenic
1072875419 10:99168081-99168103 GTGTGTGTGTGTGTGTAAATAGG - Intronic
1072976574 10:100063900-100063922 GTATGTGTGTATATGTAGGTGGG + Intronic
1073494105 10:103875909-103875931 GTGTGTGTGTATATATATTTAGG - Intergenic
1073588547 10:104734084-104734106 GTGTGTGAGTAGATGTATGTTGG + Intronic
1073964465 10:108972773-108972795 GTGTGTGTGTGCATGTGTTTTGG + Intergenic
1074180455 10:111058491-111058513 GTGTGTGTGTGCATATAAAATGG + Intergenic
1074236733 10:111592255-111592277 GTGTGTGTGTGCATGTATGTAGG + Intergenic
1074710226 10:116171070-116171092 GTGTCTATGTACATGAAAATAGG - Intronic
1074844251 10:117383127-117383149 GTGTGTGTGTACATGTGTGTTGG + Intergenic
1074863800 10:117533284-117533306 GTGTGTGTGTGAATGTATTTGGG - Intergenic
1074950584 10:118330675-118330697 GTTTGGGTGTACATGGAACCAGG - Intronic
1075450775 10:122550681-122550703 GTGTGTGTGTACATGTACAGGGG - Intergenic
1075483019 10:122798451-122798473 GTGTGTGTGTATATGTGTGTGGG - Intergenic
1075541290 10:123316698-123316720 GTGTGTGTGTGTATGTAATAGGG + Intergenic
1076535842 10:131176417-131176439 CTCTGTGTGTACATGTGTCTTGG - Intronic
1076535843 10:131176455-131176477 GTCTGTGTGTGCATGTTTCTTGG - Intronic
1076535851 10:131176641-131176663 CTCTGTGTGTACATGTGTCTTGG - Intronic
1076535852 10:131176679-131176701 GTCTGTGTGTGCATGTTTCTTGG - Intronic
1076535863 10:131176911-131176933 GTGTCTGTGTGCATGTATCTTGG - Intronic
1076726312 10:132415592-132415614 GTGTGTGAGTAAATGTGAGTGGG - Intronic
1076886043 10:133262870-133262892 GTGTGTGTGTACGTGTCTCCAGG - Exonic
1077425084 11:2471872-2471894 GTGTGTGTGCACATGTGTATAGG + Intronic
1077425091 11:2471994-2472016 GTGTGTGTGCACATGTGTATAGG + Intronic
1077868863 11:6244573-6244595 GTGTGTGTGTACTGGTAAGTGGG - Intergenic
1078065930 11:8079690-8079712 GTGTGTGTGTGCATGTGTGTAGG + Intronic
1078343544 11:10521787-10521809 ATGTCTGTGTATATGTAACCAGG + Intronic
1078955480 11:16189431-16189453 GTGTGTGTGTACACATATGTTGG + Intronic
1079173071 11:18114643-18114665 GAGTGTGTGAACATGTAAATAGG + Intronic
1079446907 11:20565738-20565760 GTGTGTGTGTCCAAGAAAGTAGG + Intergenic
1079465867 11:20730354-20730376 GTGTGTGTATGCATTTTACTGGG + Intronic
1079544523 11:21616519-21616541 GTGTGTATGTACATGGTAGTGGG - Intergenic
1079581944 11:22076155-22076177 GTGCGTGTGTGCATGTAGGTGGG + Intergenic
1079688560 11:23393780-23393802 GTGTCTGTGTCCATGTGGCTGGG - Intergenic
1079918904 11:26407026-26407048 GTGTGTGTGTATATATATATGGG + Intronic
1080159981 11:29162191-29162213 GTGTGTGTTCACATGTCTCTGGG + Intergenic
1080229815 11:30007280-30007302 GTGTGTGTGTGTATCTAACATGG - Intergenic
1080292183 11:30683315-30683337 ATGTGTGAGTTCATGGAACTAGG + Intergenic
1080953110 11:37059487-37059509 GTGTGTATGTATATGTTACCAGG - Intergenic
1080953111 11:37059547-37059569 GTGTATGTGTGCATGTAGGTTGG - Intergenic
1080963181 11:37184120-37184142 GTGTGTGTGTGTGTGTGACTGGG - Intergenic
1080971012 11:37276975-37276997 GTGTGTGTGTGTATGAGACTTGG - Intergenic
1081020478 11:37941465-37941487 GTGTGTGTGTATATATAAAATGG - Intergenic
1081062336 11:38495593-38495615 GTGTGTGTGTGCATTTTCCTGGG + Intergenic
1081475891 11:43430698-43430720 GTGTGTGTGTGCGTGTATGTAGG - Intronic
1081994777 11:47356388-47356410 GTGTGAGTGTGCATGTGAGTGGG - Intronic
1082209839 11:49485483-49485505 GTGTGTGTGTACACATACATTGG - Intergenic
1083266539 11:61549643-61549665 GTGTGTGTCTGCATGCACCTAGG - Intronic
1083559161 11:63658252-63658274 GGGTGTGTGTATATCCAACTTGG - Intronic
1084676199 11:70636794-70636816 GTGTGTGTGAACATGTGTGTGGG + Intronic
1086580063 11:88389451-88389473 GTGTGTGTGTGTTTGTAAGTGGG - Intergenic
1087401350 11:97670348-97670370 CTGTGTGTGTGCATGTATGTAGG - Intergenic
1087650252 11:100858115-100858137 GTGTGTGTGTTTATGTAATTAGG + Intronic
1088126430 11:106430506-106430528 CTCTGTGTGTATATGTAACTTGG - Intergenic
1088426050 11:109704574-109704596 GTGTGTGTGTGTGTGTAACAAGG - Intergenic
1089298693 11:117484927-117484949 GTGTGTGTGTGTGTGTAAGTGGG + Intronic
1089681284 11:120120332-120120354 GTGTGTGTGTACATGTGTGGGGG - Intronic
1090366406 11:126210510-126210532 GTGTGTGTGTGTATGTATGTTGG - Intronic
1090399183 11:126437711-126437733 GTGCATGTGTACATGTATTTCGG - Intronic
1090409120 11:126495507-126495529 GTGTGTGTGGACGTGTTGCTAGG + Intronic
1090833527 11:130437208-130437230 GTGTGTGTGCACATGTGTGTAGG - Intergenic
1091079195 11:132650565-132650587 GTGTGTGTGTGTATGTCAATTGG - Intronic
1091954251 12:4624816-4624838 GTGTGTGTGTATATAAAAGTGGG + Intronic
1092140681 12:6181341-6181363 GTGTGTGTGTCTATGTTCCTGGG + Intergenic
1092942594 12:13424168-13424190 GTGTGTGTGTGCAGGTAAGTAGG - Intergenic
1093535272 12:20216081-20216103 ATGTGTGTCTATATGTAAGTAGG + Intergenic
1094299168 12:28941663-28941685 GTTTGTGTGTACATTAAAGTTGG + Intergenic
1094410804 12:30167170-30167192 GTGTGTGTGTGTATGTATGTAGG - Intergenic
1094485175 12:30920161-30920183 ATATGTGTGTACATGTGAATAGG + Intergenic
1095467402 12:42502158-42502180 GTGTGTGTGTATATATATATAGG - Intronic
1095693482 12:45117647-45117669 GTGTGTGTGTCTATGTGAGTGGG - Intergenic
1095731925 12:45515286-45515308 GTGTGTGTGTGCATGTCTATGGG - Intergenic
1096059728 12:48686538-48686560 GTGTGTGTGTTTAGGTAACTAGG - Intergenic
1096263818 12:50108755-50108777 GTGTATGTGAAGATGTAATTAGG - Intronic
1096481144 12:51941865-51941887 GTGTGTGTTTATGTGTAGCTGGG + Intergenic
1096693341 12:53334325-53334347 GTGTGTGTGTGTGTGTAAGTTGG - Intronic
1097369498 12:58759315-58759337 GTGTGTGTGTATGTTTATCTTGG - Intronic
1097487150 12:60218076-60218098 GTGTGTGTATATATGTAAAATGG - Intergenic
1097525005 12:60722325-60722347 GTGTGTGTGTATATATATATAGG + Intergenic
1097771755 12:63594481-63594503 GTGTGTGTGTGTATGAAACTTGG + Intronic
1097896572 12:64829498-64829520 GTGTGTCTGTACGTGTAGGTAGG + Intronic
1098084970 12:66832906-66832928 GTGTCTGTGTTCATGTTGCTAGG - Intergenic
1099125643 12:78753444-78753466 GTGGGAGGGTACATGTAATTAGG + Intergenic
1100216824 12:92458924-92458946 GTGTGTGTGTATATATATTTTGG - Intergenic
1100680808 12:96918185-96918207 GTGTGTTTGTATTTTTAACTTGG + Intronic
1100983503 12:100183441-100183463 GTGTGTGTGTGCATATAAGTAGG - Intergenic
1101264596 12:103070503-103070525 GTGTGTGTGTATGTGTATGTAGG - Intergenic
1101473602 12:105022321-105022343 GTGTGTGTGCACATGAATTTTGG + Exonic
1102029672 12:109732729-109732751 GTGTGTGTGTACACGTGTGTGGG - Intronic
1102237879 12:111305988-111306010 CTGTGTGTGTCCATGTTCCTGGG + Intronic
1102465637 12:113129511-113129533 GTGTGTGTGCACCTGTTTCTGGG - Intronic
1102706971 12:114890056-114890078 GTGTGTGTGCACATGATTCTTGG - Intergenic
1102897289 12:116608652-116608674 GTGTGTGTATATATGTCACATGG + Intergenic
1102937756 12:116911600-116911622 GTGTATGTGTGCATGTTACTGGG + Intronic
1103774029 12:123352147-123352169 GTATGTTTGTATATGTAAATTGG - Intronic
1104245564 12:127037834-127037856 GTGTGTGTGTATATATATGTTGG + Intergenic
1104596505 12:130123930-130123952 GTGTGTGTATACATATATATGGG + Intergenic
1104645929 12:130497187-130497209 GTGTGTTTGGAGATGTAACTAGG - Intronic
1104792201 12:131490550-131490572 GTGTGTGTGGACTTGTAAGTAGG - Intergenic
1106222380 13:27757207-27757229 GTGTGTGTGTGTGTGTAGCTGGG - Intergenic
1106486072 13:30173883-30173905 GTGTGTGTGCACATGTGTGTGGG - Intergenic
1106782690 13:33075404-33075426 GTGTGTGTGTGTAGGTAAGTCGG - Intergenic
1107107135 13:36656493-36656515 GTGTGTGTGTGTATGTAGCCAGG - Intergenic
1107396568 13:40024226-40024248 GTGTGTGCGTGCATGAACCTAGG + Intergenic
1108004361 13:45932334-45932356 GTGTGTGTGTGCATGTGTGTGGG - Intergenic
1108187768 13:47905551-47905573 GTGTGTGTGTGTATGTATGTAGG - Intergenic
1108425854 13:50299430-50299452 ATGTGTGTGTACATGTATATGGG - Intronic
1108757105 13:53516923-53516945 GTGTGTGTGTGCAGGTAGATGGG - Intergenic
1108789651 13:53952210-53952232 GTGTGTGTTTGCATGTATGTTGG - Intergenic
1109205768 13:59481068-59481090 GAGTGTGTGTGCATGTAAGAGGG + Intergenic
1109508775 13:63340404-63340426 GTGTGTGTGTATATATATTTAGG + Intergenic
1109556483 13:63982388-63982410 GTATGTGTGTACATGCACATGGG + Intergenic
1110228669 13:73145997-73146019 GTGTGTGTGTGTGTGGAACTTGG + Intergenic
1110397456 13:75048255-75048277 GTGTGTGTGTATATATAAAATGG + Intergenic
1110500793 13:76225340-76225362 GTGTGTGTGTGCATGTGTTTAGG - Intergenic
1110921538 13:81093525-81093547 GTGTGTGTGTGTATGTATGTTGG + Intergenic
1112439379 13:99415002-99415024 GTGTGTGTGCACGTGTGAGTGGG - Intergenic
1112619018 13:101035653-101035675 GTGTGTGTGTGTGTGTAAATTGG + Intergenic
1112648881 13:101369188-101369210 GTGTGTGTGTGTATGCTACTAGG + Intronic
1113075454 13:106463600-106463622 GTGTGTGTGTGTGTGTAACATGG - Intergenic
1113290297 13:108898380-108898402 GTGTGTGTGTATACATACCTAGG + Intronic
1113354018 13:109560823-109560845 ATGTATCTGTACATGTATCTAGG + Intergenic
1113354020 13:109560850-109560872 ATGTATCTGTACATGTATCTGGG + Intergenic
1113354022 13:109560877-109560899 ATGTATCTGTACATGTATCTGGG + Intergenic
1113354024 13:109560904-109560926 ATGTATCTGTACATGTATCTGGG + Intergenic
1113870561 13:113557182-113557204 GTGTGTGTGCACATGTGTGTAGG + Intergenic
1114061478 14:19021345-19021367 GTGTGTGTGTGTGTGTGACTAGG + Intergenic
1114100770 14:19378601-19378623 GTGTGTGTGTGTGTGTGACTAGG - Intergenic
1114240092 14:20858939-20858961 GTGTGTGTGCACATGTGGTTTGG + Intergenic
1115153530 14:30313004-30313026 GTGTGTGTGTGCATGCATGTTGG - Intergenic
1116103653 14:40472776-40472798 GTGTGTGTGTATTTCTAAATTGG + Intergenic
1116580879 14:46639729-46639751 GTGTGTGTGTATGTGTGAGTGGG + Intergenic
1116681616 14:47977824-47977846 GTGTGTGTGTATGTGTGAATAGG - Intergenic
1116705391 14:48290825-48290847 GTATGTGTGTATGTGTACCTTGG + Intergenic
1117950261 14:61075821-61075843 GTGTGTGTGTGTATGTATTTGGG + Intronic
1118167863 14:63355859-63355881 GTGTGTGTGTGCAGGGAACAGGG - Intergenic
1118323377 14:64766174-64766196 GTGTGTGTGTATGTGTATGTGGG + Intronic
1118330859 14:64815020-64815042 GTGTGTGTGTGCATGTAAGCAGG + Intronic
1118562159 14:67097556-67097578 GTGTGTGTGTGCAGGTATGTAGG - Intronic
1118646444 14:67845659-67845681 GTGTGTGTGTATATGTGACAGGG - Intronic
1119109260 14:71956400-71956422 GTGTGTGTGTATATATATGTAGG + Intronic
1119430115 14:74561748-74561770 GTGAATGTGTACACATAACTAGG + Intronic
1119852094 14:77873469-77873491 GTGTGTGCCTGCATGTAACCGGG + Intronic
1120255690 14:82116408-82116430 GTGTGTGTGTGCCTTTAAGTTGG - Intergenic
1120350552 14:83352361-83352383 GTGTGTGTATATATGTAAAGGGG - Intergenic
1120810793 14:88801410-88801432 GTGTGTGTGTGTTTGTAGCTGGG + Intergenic
1121620281 14:95342285-95342307 GTGTGTATGTACCTGTTAATAGG + Intergenic
1121725206 14:96142426-96142448 GTGTGTGTATACATTTAAACGGG - Intergenic
1121809917 14:96875929-96875951 GTGTGTGTATAAATGTATATAGG - Intronic
1121849219 14:97204119-97204141 GTGTGTGTGTGTGTGTAAATAGG - Intergenic
1121903733 14:97720353-97720375 GTGTGTGTGCACATATAAAATGG - Intergenic
1122130083 14:99599917-99599939 TTGTGTATGTACATGCAAATAGG - Intronic
1123900108 15:24868089-24868111 GAGTGTGTGTGCATGTATATGGG + Intronic
1124123318 15:26911360-26911382 GTGTGTGTGTGCATGCAGCAAGG - Intronic
1124250876 15:28105924-28105946 GGGTGTGTGTGCATGTGTCTGGG + Intergenic
1124250916 15:28106230-28106252 GTGTGTGTGTGCATGTGTCGGGG + Intergenic
1124407006 15:29402312-29402334 GTGTGTGTATATATGTATATTGG + Intronic
1124483724 15:30098584-30098606 GTGTGTGTGTGTATGTATATGGG + Intergenic
1124519855 15:30398642-30398664 GTGTGTGTGTATATGTATATGGG - Intergenic
1124538799 15:30567579-30567601 GTGTGTGTGTATATGTATATGGG + Intergenic
1124759852 15:32439992-32440014 GTGTGTGTGTGTATGTATATGGG - Intergenic
1125932566 15:43611024-43611046 GTGTGTGTGTGTGTGTAAGTGGG + Intronic
1125945664 15:43710486-43710508 GTGTGTGTGTGTGTGTAAGTGGG + Intergenic
1126302733 15:47217854-47217876 GTATGTGTGTACATGCAAGCAGG - Intronic
1126548928 15:49905947-49905969 GTGTGTGTGTATATATATGTAGG - Intronic
1127101362 15:55568352-55568374 GTGTGTGTGTGTCTGTAAATGGG + Intronic
1127615736 15:60683635-60683657 GTGTGTGTGTATGTGTATCTGGG - Intronic
1129226476 15:74173419-74173441 GTGTGTGTGTACAAGTTTGTGGG - Intergenic
1129819116 15:78584645-78584667 GTGTGTGTGCACATTTTTCTAGG + Intronic
1129914913 15:79260453-79260475 GTGTGTGTTTACATGTATATTGG - Intergenic
1130162695 15:81417406-81417428 GTGTGTATGTATATGTAAGTGGG - Intergenic
1130601923 15:85281441-85281463 GTGTGTGTGCATATGTATGTGGG - Intergenic
1130766986 15:86880733-86880755 GTGTGTGTGCATATGTATGTGGG + Intronic
1131619413 15:94051365-94051387 GTGTGTGTGTGTATGTATTTGGG - Intergenic
1131998046 15:98151833-98151855 GTGTGTGTATAAATGAAGCTGGG + Intergenic
1132052888 15:98625005-98625027 GTGTGTGTGTGCATGATTCTAGG + Intergenic
1132126338 15:99228943-99228965 GTATGTGTGTATATGTATGTAGG - Intronic
1132285297 15:100658261-100658283 GTGTGTGTGTTCATGCTCCTCGG + Intergenic
1202960579 15_KI270727v1_random:119947-119969 GTGTGTGTGTGTGTGTGACTAGG - Intergenic
1132475432 16:134216-134238 GTGTGTGTGTACATGTGCATAGG - Intronic
1132505458 16:306156-306178 GTGTGTGTGTACGTGTGTGTGGG - Intronic
1133546027 16:6807906-6807928 GTGTGTGTGTATATATATATAGG + Intronic
1133559814 16:6940796-6940818 GTGTGTGTGTGTGTGTAGCTGGG + Intronic
1134059843 16:11192496-11192518 GTGTGTGTGTGCATGTCTCTGGG - Intergenic
1134147676 16:11779786-11779808 GTGTGTGTGTACACGTGTGTGGG + Intronic
1134782249 16:16908895-16908917 GTGTGTGTGTGCGTGTGTCTGGG + Intergenic
1135230818 16:20706098-20706120 GTGTGTGTATACATAAAAATTGG + Intronic
1135856079 16:26011729-26011751 GTGTGTGTGTGCATGTGTGTAGG + Intronic
1136253054 16:29019410-29019432 GTGTGTGTGTGTGTGTAGCTGGG - Intergenic
1136702262 16:32154988-32155010 GTGTGTGCATACGTGTGACTGGG - Intergenic
1136765404 16:32772500-32772522 GTGTGTGCATACGTGTGACTGGG + Intergenic
1136802695 16:33097884-33097906 GTGTGTGCATACGTGTGACTGGG - Intergenic
1137481726 16:48857435-48857457 GTGTCTGTGTCTATGTCACTGGG + Intergenic
1137505110 16:49047950-49047972 CTGTCTTTGTCCATGTAACTGGG - Intergenic
1137604356 16:49777261-49777283 GTGTGTGTTTACATGTGCATGGG + Intronic
1137636463 16:49991206-49991228 GTGTGTGTGTGTGTGTAGCTAGG - Intergenic
1137636465 16:49991234-49991256 GTGTGTGTGTGTGTGTAGCTGGG - Intergenic
1137916414 16:52435448-52435470 GTGTGTGTGTGCGTGTATTTGGG + Intergenic
1138061159 16:53891652-53891674 GTGTGTGTGTACGTGAGACAAGG - Intronic
1138100180 16:54246107-54246129 GTGTGTGTGTACAAGTGGGTGGG + Intronic
1138375248 16:56558853-56558875 GTGTGTGTGTGCATATATTTGGG + Intergenic
1138464485 16:57178069-57178091 CTATGTGTGTCCATCTAACTTGG - Intronic
1138515509 16:57533683-57533705 GTGTGTGTGTGCACGTTACTGGG - Intronic
1138515516 16:57533741-57533763 GTGTGAGTGTGCACGTTACTGGG - Intronic
1138560195 16:57796735-57796757 GTGTGTGTGTGCATGCATATAGG - Intronic
1138885724 16:61075737-61075759 GTATGTGTGTATATGTATGTGGG - Intergenic
1138976667 16:62215855-62215877 GTGTGTGTGTATATGTGGCAGGG + Intergenic
1139001311 16:62513514-62513536 GTATGTTTGTACATGTAAGTGGG - Intergenic
1139310268 16:66022239-66022261 GTTTGTGTATACATGTATGTGGG - Intergenic
1140046691 16:71444239-71444261 GTGTGTGTGTCTATGTATGTGGG + Intergenic
1140268891 16:73445306-73445328 GTGTGTGTGTATATGTATGGGGG + Intergenic
1140526668 16:75628764-75628786 GTGTGAGTGAACATGTTACCAGG + Intronic
1140756582 16:78072900-78072922 GTGTGTGTGTATGTTTAACAGGG + Intergenic
1141162089 16:81636083-81636105 GTGTGAGTGTGTGTGTAACTGGG + Intronic
1141243302 16:82283295-82283317 GTGTGTGTGTGCATGTGTGTTGG + Intergenic
1141375976 16:83531210-83531232 TTGTCTGTTTACATGTAACTAGG + Intronic
1141618063 16:85221336-85221358 GTGTGTGTGTGCATGTACTTGGG - Intergenic
1141909849 16:87051219-87051241 GTGTGTGTGTACATGTATGTTGG + Intergenic
1141928899 16:87187511-87187533 GTATGTGTGTACATGTGTGTGGG + Intronic
1141928978 16:87188164-87188186 GTGTATGTGTACATGTGTGTAGG + Intronic
1203067793 16_KI270728v1_random:1034727-1034749 GTGTGTGCATACGTGTGACTGGG + Intergenic
1143232661 17:5370231-5370253 GTGTGTGTGTACGTATGTCTTGG + Intronic
1143269172 17:5663020-5663042 GTGTGTGAGTGCATGTCACATGG - Intergenic
1143825004 17:9598404-9598426 GTGTGTGTGTACATGGGGCTGGG + Intronic
1144510520 17:15871266-15871288 GTGTTTGTGTACATTAAAGTGGG - Intergenic
1144747489 17:17625516-17625538 GTGTGTGTGAATATGTGAGTGGG - Intergenic
1145174680 17:20688991-20689013 GTGTTTGTGTACATTAAAGTGGG - Intergenic
1145754525 17:27381024-27381046 GCGTGTGTGTGCATGTAAATCGG - Intergenic
1145977974 17:28995328-28995350 CTGTGTGTGTGCATGTATGTGGG + Intronic
1146051265 17:29555466-29555488 GTGTGTGTGTACATATATGGGGG + Intergenic
1146417072 17:32644800-32644822 GTGTGTCTCTACATGTAAGATGG + Intronic
1146494721 17:33311448-33311470 GTGTGTGTGTAGATGTGTGTAGG + Intronic
1146928407 17:36761075-36761097 GTGTGTGTGGATATGTGAATAGG + Intergenic
1146982585 17:37178917-37178939 GTGGGTGTGTAGATGAAACAGGG - Intronic
1147177008 17:38662227-38662249 GTGTGTGTGTGCATGTGCATAGG + Intergenic
1147584013 17:41642625-41642647 GTATGTGTGTACAGGCACCTTGG + Intergenic
1147585503 17:41651907-41651929 GTGTGTGTGTGCATGTGTGTTGG - Intergenic
1147868297 17:43568899-43568921 GTGTGTGTGTACCTGTGCATGGG + Intronic
1148715860 17:49715356-49715378 GTGTGAGTGAAGATGTAGCTGGG - Intronic
1148746807 17:49922953-49922975 TTGTGTGTGTACATGTGTCTGGG + Intergenic
1149767074 17:59288284-59288306 GTGTGTGTGTAAATATCAGTTGG - Intergenic
1150238671 17:63614204-63614226 GTGTGTGTGTGTGTGTAACAGGG + Intergenic
1151005048 17:70425664-70425686 GTGTGTGTGTGTGTGTAACAGGG - Intergenic
1151177988 17:72304970-72304992 GTGGGTGTGTAAATGTATGTTGG + Intergenic
1151313906 17:73310738-73310760 GTGTGTGTGTGTGTGTGACTGGG - Intronic
1151979511 17:77500174-77500196 GAGTGTGTGTGCATGGAAGTTGG + Exonic
1152062669 17:78090130-78090152 GTGTGTGTGTGCATGTGCATAGG + Intronic
1152159314 17:78657545-78657567 GGGTGTGTGTGCATGTACCGGGG + Intergenic
1152881374 17:82817954-82817976 GTGTGTGTGAATGTGTAGCTGGG + Intronic
1152986607 18:327186-327208 GTGTGTGTGTGAATGTAAGATGG + Intronic
1153180982 18:2432723-2432745 GTGTGTGTGTGCATGTGTGTAGG - Intergenic
1153289157 18:3483335-3483357 GTGCGTGTGTACATGGAAGGAGG + Intergenic
1153317212 18:3735979-3736001 GTGTGTGTGTGCATGTGGCATGG - Intronic
1153363423 18:4224970-4224992 GAGTGTGTGTACCTGAAGCTGGG - Intronic
1153714609 18:7834477-7834499 GTGTGTGTATACTTGTATATTGG - Intronic
1153953921 18:10080247-10080269 GTGTGTGTGTACAGGGTAGTGGG + Intergenic
1154453141 18:14496056-14496078 GTGTGTGTGTGTGTGTGACTAGG - Intergenic
1155633040 18:27918037-27918059 GTGTGTGTGCACATGTTTTTTGG + Intergenic
1155783366 18:29868350-29868372 GTGTGTGGGTATATGTATCTAGG + Intergenic
1156069243 18:33186292-33186314 GTGTGTGTGTATTTTAAACTGGG + Intronic
1156090125 18:33456905-33456927 GTGTGTGTGTACAGCTTTCTGGG - Intergenic
1156142644 18:34134441-34134463 GTGTGTGTGTGTGTGTCACTTGG - Intronic
1156440798 18:37185708-37185730 GTGTGTGTGTATATATCAGTAGG - Intronic
1156480831 18:37435355-37435377 GTGTGTGTGCACGTGTGTCTTGG + Intronic
1156628509 18:38939458-38939480 GTGTGTGTGTGTATGTGACAGGG + Intergenic
1156732393 18:40210049-40210071 GTGTGTGTGTACATGTTAGTGGG + Intergenic
1156930492 18:42636450-42636472 GTGAGTGTTGACATGAAACTGGG + Intergenic
1157300488 18:46475330-46475352 GTGTGTGTGTACATGAATGTGGG - Intergenic
1157441892 18:47717951-47717973 GTGTGTGTGTGTGTGTAAATAGG + Intergenic
1157509300 18:48258088-48258110 GTTTGTTTGTACATGTTAGTAGG - Intronic
1158018751 18:52815399-52815421 GTGTGTGTGTACGTGTGAGAAGG - Intronic
1159363748 18:67438657-67438679 CTGTGTGAGGACATCTAACTTGG - Intergenic
1159559495 18:69978423-69978445 GTGTGTGTGTATATATATATGGG + Intergenic
1160000849 18:75020332-75020354 GTGTGTGTGTATATATATATAGG + Intronic
1160110083 18:76018501-76018523 GTGTGTGTGTGTGTATAACTTGG - Intergenic
1160305192 18:77727032-77727054 GTGTGTGTTTGCATGTATTTGGG - Intergenic
1160686038 19:437020-437042 GTGTGTGTGTGCATGTGTGTGGG - Intronic
1161772685 19:6239751-6239773 GTGGGTGTGTATATGTACATAGG - Intronic
1162587483 19:11569421-11569443 GTGTGTGTGTGTGTGTATCTTGG - Intronic
1162778409 19:12994054-12994076 GTGTGTGTGTACATGTACGGAGG + Intergenic
1162994507 19:14325670-14325692 CTGTGAGTCTATATGTAACTGGG - Intergenic
1163561895 19:18024151-18024173 TTGTGTGTGTACATGCCTCTGGG - Intergenic
1163972873 19:20816929-20816951 GTGTGTGTGAACATATAAAATGG + Intronic
1164882632 19:31747182-31747204 GTGTGTGTGTAGATATATATAGG + Intergenic
1164882638 19:31747246-31747268 GTGTGTGTGTAGATATATGTAGG + Intergenic
1164882647 19:31747558-31747580 GTGTGTGTGTAGATATATGTAGG + Intergenic
1164882649 19:31747626-31747648 GTGTGTGTGTAGATATATATAGG + Intergenic
1165123426 19:33578157-33578179 GTGTGTGTGCACATGCAATGTGG + Intergenic
1165267154 19:34669708-34669730 GTGTGTGTGTGTGTGTAAGTGGG - Intronic
1166199085 19:41224732-41224754 GCGTGTGTGTATATGTCACAGGG + Intronic
1166389952 19:42403277-42403299 GTGTGTGTGTGTGTGTGACTGGG + Intronic
1166963615 19:46514854-46514876 GTGTGTGTGGACATGTGAGAGGG - Intronic
1167091903 19:47350043-47350065 GTGTGTGTGTGTATGTACATAGG + Intronic
1168010867 19:53530743-53530765 GTCTGTGTGTGCATGTACATTGG + Intronic
924983972 2:251619-251641 GTGTGTGTGTGCACCTCACTGGG + Intronic
925029753 2:641246-641268 GTGTGTGTGTATATGTGAATGGG - Intergenic
925417499 2:3681008-3681030 GTGTGTTTATACATGTACTTAGG + Intronic
925852996 2:8101668-8101690 GTGTATGTGTGCATGTAAGTTGG - Intergenic
925999304 2:9317373-9317395 GTGTGTGTGTGGATGTGAGTTGG - Intronic
926597504 2:14807471-14807493 GTGTGTGTGTGTGTGTAACCGGG + Intergenic
927339019 2:21959609-21959631 GTGTGTGTGTGTATGTATTTTGG + Intergenic
927447199 2:23173775-23173797 GTGTGTCTCTACATGTAAGATGG - Intergenic
927845789 2:26472148-26472170 ATGTGTGTGTGCATGTATGTGGG - Intronic
928171301 2:29005189-29005211 GTGTGTGTGTGCATGTGTGTGGG + Intronic
928222373 2:29415050-29415072 GTGTGTGTATACATGTGTGTGGG - Intronic
928387991 2:30885713-30885735 GTGTGTGGGTACATACAACGGGG + Intergenic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
929258589 2:39839794-39839816 GTGTGTGTGTATGTGTGACTAGG + Intergenic
929259236 2:39845962-39845984 GTGTGTGTGTGTATGTATGTGGG + Intergenic
929334543 2:40725169-40725191 GTGTGGGTGTTTGTGTAACTAGG + Intergenic
929741256 2:44603027-44603049 GTGTGTGTGTATATATAGGTTGG - Intronic
929795786 2:45057395-45057417 GTGTGTGTGTACCTGTGTGTGGG + Intergenic
930687991 2:54329943-54329965 GTGTGTGTTTACATTCACCTTGG - Intergenic
930713513 2:54571534-54571556 GTGTGTGTGTACATACAATTAGG - Intronic
931663915 2:64596317-64596339 GTGTGTGTGTACGTGTGCATTGG - Intergenic
931704854 2:64938770-64938792 GAGTGTGTGTGCATGTATCAGGG + Intergenic
932096220 2:68851176-68851198 GTGTGTGTGTACATCTACTTAGG - Intergenic
933009705 2:77044560-77044582 GTGTGTGTGTGCATGCAAAAGGG + Intronic
934971753 2:98769868-98769890 GTTTGTGTGGACATGTGACTCGG + Intergenic
935168138 2:100587636-100587658 GTGTGTGTATACATATATATGGG - Intergenic
935274551 2:101464730-101464752 GTGTGTGACTACATGCAGCTAGG - Intronic
935308862 2:101762814-101762836 GTGTGGGTGTAATTGGAACTGGG + Intronic
935734529 2:106096194-106096216 GTGTGTGTGTGTATGTATGTGGG + Intronic
936545654 2:113390836-113390858 GTGTGTGTTTGTATGGAACTAGG + Intergenic
936937397 2:117851531-117851553 GTGTGTGTGTGCATGTGTGTTGG + Intergenic
936968760 2:118153585-118153607 GTGTGTGTGCACATGTGCTTGGG - Intergenic
937092833 2:119217910-119217932 GTGTGTGTGTCCATGAAATCAGG + Intergenic
937234104 2:120419976-120419998 GTGTGTGTGGAAAGGTAAATGGG - Intergenic
937563018 2:123247899-123247921 GTGGGTTTGTGCATGAAACTGGG - Intergenic
937581328 2:123492414-123492436 GTGTGTGTGTGCATGTATGTGGG + Intergenic
937717936 2:125056283-125056305 GTGTGTGTGTACATGTGATTTGG - Intergenic
939014718 2:136888973-136888995 GTGTGTGTGTACATGTATTTAGG + Intronic
939304900 2:140399158-140399180 GTGTGTGTGTGTGTGTATCTTGG - Intronic
939370162 2:141288960-141288982 GTGTGTTTGTACATGTACTTTGG + Intronic
940415922 2:153419651-153419673 ATGTGTGTGTGCATGTATTTAGG - Intergenic
941351243 2:164439802-164439824 GTGTGTATGTACATGGCATTAGG - Intergenic
941553414 2:166944619-166944641 GTTCATGTGTTCATGTAACTGGG + Intronic
941667535 2:168257443-168257465 GTGTGTGTGTATATATAAAGGGG - Intergenic
942023480 2:171890487-171890509 GTGTGTGTGTGTGTGTAACAAGG + Intronic
942869863 2:180721672-180721694 ATGTGTCTGTAGATGGAACTGGG + Intergenic
943662164 2:190570689-190570711 CTTTGTGTGGACATGTGACTAGG - Intergenic
943975088 2:194465690-194465712 GTGTGTGTGTGCATATCAGTTGG + Intergenic
944418014 2:199498108-199498130 TTGTGTGTGTGCATGTGACAGGG + Intergenic
945633487 2:212316267-212316289 GTGTGTGTGTACATGCATGTGGG - Intronic
945943544 2:215972968-215972990 GAGTGAATGGACATGTAACTGGG + Intronic
946421767 2:219569159-219569181 GTGCGTGTGTGTATGCAACTCGG + Intronic
946760069 2:222984575-222984597 GTGTGTGTGTACATATATATAGG - Intergenic
947478180 2:230470970-230470992 GTGTGTGTATATATGTATATTGG + Intronic
947492788 2:230610421-230610443 GTGTGTGTGTGTGTGTAAATGGG + Intergenic
947591706 2:231389612-231389634 GTGTGTGTGTTCATGCGTCTGGG + Intergenic
947948356 2:234125982-234126004 GTGTGTGTATATATATAATTGGG + Intergenic
948354219 2:237364835-237364857 GTGTGGGTGTACATGTGTGTGGG + Intronic
948546654 2:238736445-238736467 GTGTGTGTTTACATTTAAAGTGG + Intergenic
948692187 2:239713137-239713159 GTGTGTGTGTGAATGTGTCTGGG + Intergenic
948813715 2:240499261-240499283 GTGTGTGTGGATGTGTAAGTGGG + Intronic
948816220 2:240511670-240511692 GTGCGTGTGTGCATGTGAGTGGG + Intronic
1168889670 20:1286717-1286739 GTGTGTGTGCACAAGTGACAGGG + Intronic
1168981046 20:2003911-2003933 GTGTGTGTCTATATGTATTTGGG - Intergenic
1169269642 20:4189173-4189195 GTGTGTGTGTGTATGTAGGTAGG - Intergenic
1170329449 20:15192227-15192249 CATTGTTTGTACATGTAACTTGG + Intronic
1170613332 20:17931038-17931060 GTGTGTGTGTGTGTGTAGCTGGG + Intergenic
1170784790 20:19458172-19458194 GTGTGTGTGTGCATGTGAGGGGG - Intronic
1170881927 20:20304576-20304598 GTGTGTGTGAGCGTGTGACTGGG - Intronic
1170900579 20:20458689-20458711 GTGTGTGTGTATATATATATAGG - Intronic
1171098660 20:22359608-22359630 GTGTGTGTGTGCATGTATGGTGG - Intergenic
1171104862 20:22422929-22422951 GTGTGTGTGTGCTTGTATGTAGG - Intergenic
1172248581 20:33463155-33463177 GTGTGTGTGTGTGTGTAACCAGG - Intergenic
1172275398 20:33676449-33676471 ATGTGTGTGTGCATGTACCGGGG - Exonic
1172913438 20:38426983-38427005 GTGTGTGTGTATGTGTAACTTGG - Intergenic
1173104536 20:40121146-40121168 CTGTGTGGGTAGATGTTACTGGG - Intergenic
1173503708 20:43571213-43571235 GTATGTGTGTACATGTGCATGGG - Intronic
1173547404 20:43909452-43909474 GTGTGTGTGTGTATGTATGTAGG + Intergenic
1173583105 20:44161067-44161089 GTGTGTGTGTATGTGTGACAGGG - Intronic
1173850945 20:46217417-46217439 GTGTGTGTGTGAATGTATCTGGG - Intronic
1173880861 20:46411224-46411246 GTGTGTGTGTGTGTGTAATTGGG + Intronic
1173950028 20:46984753-46984775 GTGTGTGTATACATATATATAGG + Intronic
1174712581 20:52722986-52723008 GTGTGTGTGCACGTGTTACATGG + Intergenic
1176176891 20:63732289-63732311 GTGTGTGTGTGCATGTGTGTGGG + Intronic
1176176900 20:63732346-63732368 GTGTGTGTGTGCATGTGTCAGGG + Intronic
1176430579 21:6573259-6573281 GTGTGTGTGTCCCTGTGAGTGGG + Intergenic
1176442889 21:6792193-6792215 GTGTGTGTGTGTGTGTGACTAGG + Intergenic
1176821044 21:13657207-13657229 GTGTGTGTGTGTGTGTGACTAGG + Intergenic
1176839858 21:13830153-13830175 GTGTGTGTCTGCATGTAGGTGGG - Intergenic
1177076688 21:16584306-16584328 GTGTGTGTGTGTGTGTACCTTGG - Intergenic
1177389288 21:20445781-20445803 GTGTGTGTGTGTATGTAAGAAGG + Intergenic
1177399696 21:20586914-20586936 GTGTGTGTGTATATATACCTGGG + Intergenic
1177407948 21:20694513-20694535 GTGTGTGTGTATATATATATAGG + Intergenic
1178028629 21:28497865-28497887 GTGTGTGTGTATATATAGCCTGG + Intergenic
1178214996 21:30585694-30585716 GTGTGTGTGTTCTTGTTACTTGG - Intergenic
1178320759 21:31603586-31603608 GTGTGTGTGTGTGTGTCACTAGG - Intergenic
1178322662 21:31617214-31617236 GTGTGTGTGTACATGTGTGGCGG - Intergenic
1178623585 21:34197419-34197441 GTGTATGTGTATATGTAAATTGG + Intergenic
1178685476 21:34707426-34707448 GTGTGTGTGTGCAGAGAACTAGG - Intronic
1179191441 21:39125671-39125693 GTGTGTGAGTACATGTGTGTTGG - Intergenic
1179366993 21:40767910-40767932 GTGCGTGTGTGCATGTTACATGG + Intronic
1179639407 21:42737224-42737246 GTGTGTGTGCATATGTAGATGGG - Intronic
1179705973 21:43180721-43180743 GTGTGTGTGTCCCTGTGAGTGGG + Intergenic
1180172815 21:46068730-46068752 GTGTGTGTGCACGTGTGCCTGGG + Intergenic
1180172839 21:46068990-46069012 GTGTGTATGCACATGTGCCTGGG + Intergenic
1180172842 21:46069016-46069038 GTGTGTCTGTGCATGTCCCTGGG + Intergenic
1180479966 22:15743945-15743967 GTGTGTGTGTGTGTGTGACTAGG + Intergenic
1180844037 22:18971837-18971859 GTGTGTGCGTGTGTGTAACTTGG + Intergenic
1181768779 22:25111215-25111237 GTGTGTGTGTGCGTGTATGTCGG - Intronic
1182063704 22:27415896-27415918 GTGTGTGTGTGCATGTGAAAAGG - Intergenic
1182532832 22:30974181-30974203 GTGTGTGTGTAAATATGACATGG + Intergenic
1182734271 22:32520111-32520133 GTGTGTGTGTGCGTGTATATAGG + Intronic
1182793686 22:32974652-32974674 GTGTGTGTGTGCATGTAAGAGGG + Intronic
1184138700 22:42564978-42565000 GTGTGTGTGTACACGCAACAAGG + Intronic
1184167121 22:42736186-42736208 GAGTGAGTGAACGTGTAACTAGG + Intergenic
1184479944 22:44740494-44740516 GTGTGTGTGTGTGTGTAAGTGGG + Intronic
1184491709 22:44813561-44813583 GTGTGTGTGTAGTTGTATGTAGG - Intronic
1184833387 22:47005665-47005687 GTGTATGTGTATATGTATATGGG - Intronic
1185192764 22:49449006-49449028 GTGTGTGTGTGTATGTGACAGGG - Intronic
1185251295 22:49802977-49802999 GTGTGTCTGTCCATGGAACTTGG - Intronic
949140274 3:624698-624720 GTGTGTGTGTGTGTGTAATTAGG - Intergenic
949143708 3:668855-668877 GTGAGTGTGTACATTTATTTAGG - Intergenic
949309716 3:2683315-2683337 GTGTGTGTGTACATGTGTGCAGG - Intronic
949742878 3:7256604-7256626 GTGTGTGTGCATAGGTAGCTAGG - Intronic
949756663 3:7419349-7419371 GTGTGTGTCCAAATGTCACTGGG - Intronic
950992536 3:17455536-17455558 GTGTGTGTGTATATATATATAGG + Intronic
951371527 3:21856024-21856046 GTGTGTCTGTGTGTGTAACTTGG + Intronic
951541640 3:23787716-23787738 GTGTGTGTGTATATATATATGGG - Intergenic
951892295 3:27578675-27578697 GTGTGTGTGTGCGTGTTACTAGG + Intergenic
951946654 3:28144980-28145002 GTGTGTGTGTATATATATATAGG + Intergenic
952051794 3:29393419-29393441 GTGTGTGTGTGCATACAATTTGG - Intronic
952867344 3:37862496-37862518 GAGTGTGTGTGCATCTAACCGGG + Intronic
952980967 3:38735552-38735574 GTGTATGTGGGTATGTAACTTGG + Intronic
953004838 3:38968581-38968603 GTGTGTGTGCACATGTGTGTTGG - Intergenic
953126847 3:40098931-40098953 GTGTGTGTGTACATTTGATTAGG + Intronic
953356456 3:42260298-42260320 GTGACTGTGTACAGGTAACTGGG - Intronic
953577590 3:44125729-44125751 GTGTGTGTGTATATGCACCTGGG - Intergenic
954329084 3:49879697-49879719 GTATGTGTGTACATGAATGTAGG - Intergenic
954426962 3:50448409-50448431 GTGTATCTGTACATGTATGTAGG + Intronic
954688032 3:52381105-52381127 GTGTGTGTGTGTATGTGACTGGG + Intronic
954936307 3:54330234-54330256 GTGTGTGTGTGTGTGTCACTTGG + Intronic
955111515 3:55955274-55955296 GTGTGTGTGTGTGTGTAAGTGGG + Intronic
955401613 3:58595689-58595711 GTGTGTGTGTGCACGCAACAAGG - Intronic
955741041 3:62092051-62092073 GTGTGTGTGTCCATGTATAAGGG - Intronic
956112191 3:65880923-65880945 GTGTGTGTGTGTATGTAACAGGG + Intronic
956889176 3:73593697-73593719 GTGTGTGTGTATATTTATTTCGG - Intronic
957148194 3:76451275-76451297 CTGTTTGTGTTCATGTAAGTAGG - Intronic
957273480 3:78061154-78061176 GTGTGTGTGTACAGATAACAGGG - Intergenic
957475581 3:80718966-80718988 GTGTGTGTGTCTATTTAACTTGG + Intergenic
957539126 3:81546189-81546211 GTGTGTGTGTGCATGTACAGTGG - Intronic
957647351 3:82949115-82949137 ATGTGTGTATACTTGTAAATTGG + Intergenic
957764247 3:84601065-84601087 GTGTGTGTGTGCGTGTATGTGGG + Intergenic
958504559 3:94957966-94957988 GTGTGTGTGCGCATGTATATAGG + Intergenic
958506971 3:94992240-94992262 GTGTGTCTGTATATGTATGTGGG + Intergenic
958556524 3:95685222-95685244 GTGTGTGTGTGTGTGTATCTTGG + Intergenic
959017831 3:101155875-101155897 GTGTGTGTGTTTATGTAGCAGGG + Intergenic
959590566 3:108075439-108075461 GTGTGTGTGTGTGTGTAACCTGG - Intronic
961380471 3:126493302-126493324 GTGTGTGTGCACATATCTCTTGG - Intronic
961406554 3:126683791-126683813 GTGTGTGTGTGCAGGTGTCTGGG + Intergenic
961406557 3:126683817-126683839 GTGTGTGTGTGCAGGTGTCTGGG + Intergenic
961487433 3:127226878-127226900 GTGTGTGTGTGTGTGTAACGAGG + Intergenic
961616128 3:128182669-128182691 GGTTGTGTGTACATGTCACAGGG + Intronic
961666237 3:128494642-128494664 GTGTGTATGTGCATGTATCTAGG + Intergenic
961915345 3:130368549-130368571 GTGTGTGTGTGTGTGTTACTGGG + Intronic
962018422 3:131469209-131469231 GTGTGTGTGTAAGTGTAAGGAGG - Intronic
963225587 3:142858528-142858550 GTGCGTGTGTATATCAAACTAGG + Intronic
963622740 3:147632854-147632876 GTGTGTGTGTGTATGTATATAGG + Intergenic
963624271 3:147650978-147651000 GTGTGTGTGTACAGTTAATCAGG - Intergenic
963723459 3:148891471-148891493 GTGTGTGTGTGTATGTGACAGGG - Intronic
964145085 3:153450480-153450502 GTGTGTGTATGCATATCACTTGG - Intergenic
964829049 3:160862651-160862673 GTGTGTGTGTGCGTGTGCCTAGG - Intronic
965002086 3:162967291-162967313 GTGTGAGTGTGTATGTATCTAGG - Intergenic
965172548 3:165285341-165285363 ATGTGTGTGTGTATGCAACTAGG - Intergenic
966086324 3:176071253-176071275 GTGTGTGTGTGCATATACGTGGG + Intergenic
966305396 3:178527767-178527789 GTGTGTGTGTGCATGATTCTAGG - Intronic
966360405 3:179122883-179122905 GTGTGTGTGTATAAAAAACTGGG - Intergenic
966892692 3:184418575-184418597 GTGTGTGTGTGTGTGTGACTGGG + Intronic
967105349 3:186251091-186251113 GTGTGTGTGTGCATGGCAGTGGG + Intronic
967665065 3:192161499-192161521 GTGTGTGTGTGTGTGTAAATAGG - Intronic
968955089 4:3714574-3714596 GTGTGTGTGTGCATGTGTGTGGG + Intergenic
969510720 4:7616276-7616298 GTGTGTATGTATATGTGAGTGGG - Intronic
969800890 4:9564367-9564389 GTGTGTGTGTGCATGTATGTAGG - Intergenic
969832876 4:9812109-9812131 GTGTGTTATTACATGCAACTCGG + Intronic
970068066 4:12121965-12121987 GTGTGTGTGTGCATGCACATGGG - Intergenic
970651925 4:18188229-18188251 GTGTGTGTGTCCATGTATGTGGG + Intergenic
970692659 4:18637633-18637655 ATGTGTGTGTACATGTATCTTGG + Intergenic
971340384 4:25763404-25763426 GTGCATGTGTAAATGTAAATGGG - Intronic
971548782 4:27921866-27921888 GTGTGTGTGTATATATATATTGG + Intergenic
971761903 4:30776871-30776893 GTGTGTGTGTGTGTGTAAGTGGG + Intronic
971861801 4:32116721-32116743 GTATGAGTGTACATTTGACTTGG + Intergenic
971956241 4:33422933-33422955 ATGTGTGTGTGCGTTTAACTTGG + Intergenic
972291797 4:37696591-37696613 GTGTGTGTATGCATGTGCCTCGG - Intergenic
972940522 4:44189638-44189660 GTGTGTGTGTGCATGTATGTTGG - Intronic
973635562 4:52859092-52859114 GTATGTGTGTGCATGTACATGGG - Intergenic
973935158 4:55838738-55838760 GTGTGTGTGTATGTATACCTAGG - Intergenic
974913698 4:68153601-68153623 GTGTGTGTGTCCATGTGTATGGG + Intergenic
974998883 4:69196174-69196196 GTGTGTGTGTGCATGTATCGGGG + Intronic
975033534 4:69654395-69654417 GTGTGTGTGTATTTGTGACTGGG - Intergenic
975293021 4:72699474-72699496 GTGTGTGTGTGTATGTATGTTGG - Intergenic
976165423 4:82249303-82249325 GTGTGTGAGTATATTTATCTTGG - Intergenic
976337956 4:83912464-83912486 GTGTGTGTGTGCATGTGTATTGG - Intergenic
976345880 4:84000503-84000525 GTGTGTGTGTACTGGTAACATGG + Intergenic
976689763 4:87856097-87856119 GTGTGTGTGTGCATGTGTGTTGG - Intergenic
977054701 4:92176936-92176958 GTGTGTGTGTGCATTTCCCTGGG + Intergenic
977661879 4:99597996-99598018 CTGTGTGTGTGTGTGTAACTTGG - Intronic
977802155 4:101247886-101247908 GTGTGTGTGTATATATATATAGG - Intronic
978026622 4:103883758-103883780 GTGTGTGTGTATATGTGTTTTGG + Intergenic
978693193 4:111541176-111541198 GTGTGTGTGTACAGGCAGTTGGG + Intergenic
978856389 4:113399286-113399308 GTGTGTGTATACATGTGTATAGG - Intergenic
980254941 4:130366930-130366952 GTCTGTGTGTCCATATAAATAGG - Intergenic
980474500 4:133294943-133294965 GTGTGTGTGCACATGTGTGTTGG + Intergenic
981160561 4:141493682-141493704 GTGTGTGTGTATATATATATAGG + Intergenic
981541727 4:145853305-145853327 GTGTGTGTAGACATGTCCCTGGG - Intronic
981582705 4:146266410-146266432 GTGTGTGTGTCCATGTGCATGGG - Intronic
981817413 4:148847006-148847028 GTGTGTGTGTGTATGTATCTTGG + Intergenic
981845926 4:149169064-149169086 GCCTCTGAGTACATGTAACTGGG - Intergenic
982097976 4:151940732-151940754 GTGTGTGTGTGTATGTAGCCTGG + Intergenic
982114760 4:152089077-152089099 GTGTGTGTGTAATTTTAAATAGG + Intergenic
982984156 4:162183545-162183567 GTGTGTGTGTGTGTGTAAATAGG - Intergenic
983629497 4:169835314-169835336 GTGTGTGTGTATGTGTGAGTGGG + Intergenic
983747621 4:171221240-171221262 GTGTGTGTGTGCACGTACATGGG + Intergenic
983851233 4:172583127-172583149 GTGTGTGTGTATGTGTGAATTGG - Intronic
984148667 4:176097714-176097736 GTGTGTGTGTGTGTGTAAGTGGG - Intronic
984451021 4:179901618-179901640 ATGTGTGTTTATATGAAACTAGG + Intergenic
984531150 4:180917656-180917678 GTGTGTGTGAGCATGTATTTAGG + Intergenic
984603310 4:181754279-181754301 GTGTGTGTGTGTGTGTGACTGGG - Intergenic
985570181 5:640624-640646 GTGTCTGTGTCCATGTGACTGGG + Intronic
985874158 5:2582710-2582732 TTGTGTGTGTACATGTGTGTGGG - Intergenic
986075584 5:4334343-4334365 CTGTGGGTGTACTTGTTACTTGG - Intergenic
986395216 5:7322534-7322556 GTGTGTGTGTGCTTGTCAATTGG + Intergenic
986925620 5:12745054-12745076 GTGTGTGTGTGCATGTGTATGGG + Intergenic
987248275 5:16072538-16072560 GTGTGTGTGTACATACACCAAGG + Intronic
987393650 5:17400737-17400759 GTGTGAGTGTATATGTGAGTTGG - Intergenic
987505128 5:18759232-18759254 GTGTGTGTGTATGTGTATGTGGG + Intergenic
987554041 5:19422373-19422395 GTATTTATGTATATGTAACTGGG - Intergenic
987655793 5:20804238-20804260 GTGTGTGCGTGCATGTATGTAGG + Intergenic
987815410 5:22894819-22894841 GTGTGTGTGTGTATGTGATTTGG + Intergenic
987953626 5:24708108-24708130 GTGTGTATGTATATGTATTTAGG + Intergenic
988110261 5:26810180-26810202 GTGTGTGTGTGTGTGTAAATGGG - Intergenic
988226173 5:28413524-28413546 GTCTGTGTTTACATGTACCAGGG - Intergenic
988767761 5:34399670-34399692 GTGTGTGCGTGCATGTATGTAGG - Intergenic
988935769 5:36081586-36081608 GTGTGTGTGTGCATGTGTGTGGG - Intergenic
989047299 5:37285328-37285350 GTGTGTGTGTATACGTAATATGG - Intergenic
989367508 5:40673383-40673405 GTGTGTATCTACATGTATATAGG + Intergenic
989373161 5:40731355-40731377 GTGTGTGTGTATGTGTAGCAGGG - Intronic
989989800 5:50748203-50748225 GTGTGTGTGTACATGCTATAGGG + Intronic
990064574 5:51697118-51697140 GTGTGTGTGTGTGTGTAACATGG - Intergenic
990314124 5:54568084-54568106 GTGTGTGTGTGCAAGTCACAAGG + Intergenic
990483294 5:56232733-56232755 GTGTGTGTGTTCATGTGCGTGGG - Intronic
990553529 5:56908573-56908595 GTGTGCGTGTGCATGCATCTGGG + Intergenic
990644150 5:57824837-57824859 GAGTGTGTGTCTATGTATCTGGG + Intergenic
990686839 5:58313400-58313422 ATGTGTGTGTACACAAAACTAGG + Intergenic
990726541 5:58761637-58761659 GTGAGTGTGTACATGTGTGTGGG - Intronic
991225800 5:64270014-64270036 GTGTGTGTGTTATTGTTACTGGG - Intronic
991267125 5:64733363-64733385 GTGTGTGTGTATATATATGTGGG - Intronic
992419422 5:76587365-76587387 GTCTGTGTCTATATGTAAGTAGG + Intronic
992866179 5:80959495-80959517 GTGTGTGTGTATGTGTGAGTGGG + Intergenic
992908090 5:81367825-81367847 GTCTTTTTGTACATGTAAGTGGG - Intronic
993268173 5:85756005-85756027 GTGTATGTGTACATTTGTCTTGG + Intergenic
993271181 5:85798215-85798237 GTGTGTGTGTATATATATATAGG - Intergenic
993291316 5:86075220-86075242 GTGTGTGTGTGCATGTTCATGGG + Intergenic
993741110 5:91540862-91540884 GTGTGTGTGTACATATATATAGG - Intergenic
993953085 5:94199724-94199746 GTGGGTGAGTACATGTCAGTTGG + Intronic
994206515 5:97042387-97042409 GTGTGTGTGTATGTGTAATTTGG - Intergenic
994533389 5:100995274-100995296 GTATGTGTGTATATGTATATGGG + Intergenic
994548052 5:101193968-101193990 GTGTGTGTGTATATGTATGTAGG - Intergenic
994575226 5:101569390-101569412 GTGTGTGTGTATCTGTCACCTGG + Intergenic
994720911 5:103379404-103379426 GTGTGTGTGTGTATGGAACAGGG - Intergenic
994970474 5:106730763-106730785 CTGTGTGTGTACAGGTAAAGCGG - Intergenic
995138000 5:108701185-108701207 CTATGTGTGTGCATGTAATTGGG - Intergenic
995275084 5:110268584-110268606 ATGTGTGTGTATCTGAAACTTGG + Intergenic
995657331 5:114441672-114441694 GTTTGTGTGATCATGTAATTTGG + Intronic
995830901 5:116354512-116354534 GTGTGTGTGTATATGCAAGCTGG - Intronic
996412855 5:123177599-123177621 GTGTGTGTGTACATGCTCATTGG - Intronic
996469833 5:123846999-123847021 GATTGTGTGTACATATCACTTGG + Intergenic
996647894 5:125839423-125839445 CAGTGTTTTTACATGTAACTAGG + Intergenic
996918309 5:128736641-128736663 TTGTGTGTGAAAATGAAACTGGG + Intronic
996959168 5:129223540-129223562 GTGTGTGTGTATATATATATAGG + Intergenic
997487230 5:134241652-134241674 GTGTGTGTGTATATATATGTGGG + Intergenic
997646897 5:135487886-135487908 GTGTGTGTGTGCATGTGTGTTGG + Intergenic
998063549 5:139138118-139138140 GTGTGTGTGTGCCTGGCACTGGG - Intronic
998777732 5:145620816-145620838 GTGTGTGTGTGTGTGTAACAGGG - Intronic
998934065 5:147215851-147215873 GTGTGTGTGTGCATGTGTGTTGG + Intergenic
999117884 5:149180355-149180377 GTGTATGTGTACATGTGTATTGG - Intronic
999530802 5:152461599-152461621 GTGTGTGTGTGTATGTATATAGG + Intergenic
999623953 5:153500600-153500622 GTGTGTGTGTGTATGTAAGAGGG - Intronic
1000292058 5:159879665-159879687 ATGTGTGTTTACCTGTGACTCGG + Intergenic
1000584471 5:163079765-163079787 ATGTGTGTGTACATATATGTGGG + Intergenic
1000723146 5:164733744-164733766 GTGTGTGTGTACATTTAGCGGGG - Intergenic
1000836307 5:166158768-166158790 GTGTGTGTATATATGTAATGGGG + Intergenic
1001067443 5:168548029-168548051 GTGTGTGTGTGTGTGTAAATGGG - Intergenic
1001533918 5:172485234-172485256 GTGTGTGTGTGCATGTGTGTGGG + Intergenic
1001554733 5:172629036-172629058 GTGTGTGTGTGTGTTTAACTTGG - Intergenic
1002058799 5:176613943-176613965 GTGAGTGTGTGTATGTATCTCGG + Intergenic
1002590083 5:180284889-180284911 GTGTGTGTGTTTACGTAGCTGGG - Intronic
1002595557 5:180319900-180319922 GTGTGTGTGTGTAAGAAACTAGG - Intronic
1002848946 6:974294-974316 GTGTGTGTGTATATATATATGGG + Intergenic
1002952380 6:1827112-1827134 GTGTGTGTGTATGTGTATCCAGG + Intronic
1003018283 6:2486495-2486517 GTGTGTGTGTATGTGCACCTAGG - Intergenic
1003150806 6:3547554-3547576 GTGTATATGTGCAGGTAACTGGG - Intergenic
1003766317 6:9241222-9241244 ATGTCTGTGTACATGGAACCAGG + Intergenic
1003867329 6:10375283-10375305 GTGTGTGTGTGCGTGTAAAGAGG - Intergenic
1003944992 6:11066969-11066991 CTTTCTGTGTACATGGAACTGGG + Intergenic
1004127043 6:12883903-12883925 GTGTGTGTGTGCATGTGAGTGGG - Intronic
1004535811 6:16500407-16500429 GTGAGTGTGGGCATGTAATTTGG + Intronic
1004867301 6:19866786-19866808 GTGTGTGTGTGCATGTGTGTTGG + Intergenic
1004942381 6:20572910-20572932 GTTTGTGACTACATGTAACAAGG + Intronic
1005127523 6:22464594-22464616 GTGTGTGTGTATGTGTATCAAGG - Intergenic
1005173053 6:23010405-23010427 GTTTGTATGTAAAGGTAACTAGG - Intergenic
1005573702 6:27172158-27172180 GTGTGTGTGTGTATGTATATAGG - Intergenic
1005725667 6:28645307-28645329 CTGTGTGTATACATGTATATAGG + Intergenic
1006664570 6:35683168-35683190 GTGTGTGTGTATTTGAGACTGGG + Intronic
1007037950 6:38695374-38695396 GTGTGTGTATACATATACATGGG - Intronic
1007122219 6:39391967-39391989 GTGTGTGTATACATGTATTTTGG + Intronic
1007339779 6:41183582-41183604 GTGTGTGTGAATATGTGTCTGGG - Intergenic
1007418411 6:41705486-41705508 GTGTGAGTGTACATGGGAGTGGG - Intronic
1007755695 6:44097803-44097825 GTGTCTGTGGACAAGTTACTTGG + Intergenic
1008064238 6:47030604-47030626 GTGTGTGTGTGTGTGTACCTTGG + Intronic
1008248645 6:49209327-49209349 GTGTGTGTGTGCGTGTGTCTGGG - Intergenic
1008330990 6:50244243-50244265 GTGTGTGTGTATATATTTCTAGG + Intergenic
1008371093 6:50731439-50731461 GTGTGTGTGTGTATGAAAGTGGG - Intronic
1009730085 6:67590980-67591002 GTGTGTGTGTGTGTGTAAATTGG + Intergenic
1009995575 6:70891776-70891798 GTGTGTGTGTACATGTAACTTGG + Intronic
1010646612 6:78396555-78396577 GTGTGTGTGTGTGTGTCACTTGG + Intergenic
1010674533 6:78726051-78726073 GTGTGTGTGTGTGTGTAAATTGG + Intergenic
1010792335 6:80078787-80078809 GTGTGTGTATACATATGCCTGGG - Intergenic
1011595298 6:89010230-89010252 GTGTGTGTGTGCATGTGTGTGGG - Intergenic
1012165122 6:95939730-95939752 GTGTCTGTGTACTTGTGTCTCGG + Intergenic
1012452836 6:99371911-99371933 GTGAATGTGGACATGTAACAAGG - Intronic
1012519806 6:100107680-100107702 GTGTGTGTGTGTGTGTATCTGGG + Intergenic
1013083009 6:106829334-106829356 ATGTGTGTGTACATGTGAGAGGG + Intergenic
1013534862 6:111054666-111054688 GTGTGTGTGTATATGTATATTGG - Intergenic
1013629310 6:111970273-111970295 GTGTGTGTGTGCGTGTATCGGGG - Intergenic
1013799260 6:113922105-113922127 GTGTGTGTGTGTTTGTAAATAGG + Intergenic
1013895299 6:115080945-115080967 GTGTGTGTGTATATGTATGTAGG - Intergenic
1013975419 6:116072518-116072540 GTGTGTGTGTTTATTTAACCTGG - Intergenic
1014281914 6:119450902-119450924 GTGTGTGTGGAAATGGCACTGGG - Intergenic
1015337515 6:132057363-132057385 GTGTGTGTGTGTATGTAAAGGGG + Intergenic
1015730969 6:136348021-136348043 ATGTGTGTGCACACGTGACTTGG - Intronic
1016227223 6:141753104-141753126 GTGTGTGTGTGCATGTAATTTGG - Intergenic
1017695086 6:157006540-157006562 CTGTGTGTTTACTGGTAACTAGG - Intronic
1018343145 6:162873218-162873240 GTGTGTGTGTTTAGGTAACTGGG + Intronic
1018745964 6:166762396-166762418 GTGTGTGTGTGCATGTTAAACGG + Intronic
1018765586 6:166930454-166930476 GTGTGTGTGTACATGCATGTGGG - Intronic
1018765597 6:166930793-166930815 ATGTGTGTGTACATGCATGTGGG - Intronic
1018765599 6:166930832-166930854 ATGTGTGTGTACATGCATGTGGG - Intronic
1018808956 6:167283675-167283697 GTGTGTGTGTATCTCAAACTTGG - Intronic
1018949927 6:168372394-168372416 GTGTGTGTGTGCATGTACATGGG - Intergenic
1018992557 6:168685197-168685219 GTGTGTGTGTGCATGCCACCTGG + Intergenic
1019075251 6:169382069-169382091 GTGTGTGTGTACATCTTATTCGG + Intergenic
1019282680 7:208197-208219 GTGGGTGTGTAAATGTAGGTTGG + Intronic
1020314537 7:6895815-6895837 GTATGTGTGTGTATGTAACAGGG - Intergenic
1020576657 7:9940452-9940474 GTGTGTGTGTGTGTGTACCTGGG + Intergenic
1020920680 7:14260075-14260097 GTGTGTGTGTACACATATGTAGG - Intronic
1021122768 7:16815682-16815704 GTGTCTGTGTGCATATAACCAGG + Intronic
1021194695 7:17662399-17662421 GTGTGTGTGTAGGTGTATGTGGG - Intergenic
1021239244 7:18180216-18180238 GTGTGTGTGTGTATGTGTCTTGG - Intronic
1021280320 7:18708919-18708941 GTGTGTGTGTGCATGTGTGTGGG - Intronic
1021518913 7:21518984-21519006 GTATGTGTGTACATGTTAGGTGG + Intergenic
1021803695 7:24333920-24333942 GTCTGTGTGTATCTCTAACTTGG + Intergenic
1022057874 7:26758505-26758527 TTGTGTGGGTACATGAGACTTGG - Intronic
1022111226 7:27233311-27233333 GTGAGTGTGAAAATGTTACTTGG + Intergenic
1022328620 7:29356249-29356271 GTGTGTGTATACATGCACATAGG - Intronic
1022366416 7:29723742-29723764 GTGCGTGTGTGTATGAAACTTGG - Intergenic
1022366418 7:29723799-29723821 GTGTATGTGTGTATGAAACTTGG - Intergenic
1022366422 7:29723856-29723878 GTGTGTGTGTGTATGAAACTTGG - Intergenic
1022366426 7:29723903-29723925 GTGTGTGTGTGTATGAAACTTGG - Intergenic
1022931315 7:35118160-35118182 GTGTGTGTGTGTATGAAACTTGG + Intergenic
1022957805 7:35397505-35397527 GTGTGTGTGCACATGTGTGTGGG + Intergenic
1023358916 7:39396146-39396168 GTATTTGTCTACATATAACTTGG + Intronic
1023369748 7:39501364-39501386 GTGTGTGTGTACACACAAGTTGG + Intergenic
1023422951 7:40003147-40003169 GTGTGTGTGTGTGTGTAGCTGGG - Intronic
1023464499 7:40439014-40439036 GTGTGTGTGTATATATAATATGG + Intronic
1023648747 7:42346409-42346431 GTCAGTGTGTACATGTATTTAGG - Intergenic
1023765704 7:43508577-43508599 GTGTGTGTGTATGTGTATGTGGG - Intronic
1023800208 7:43827239-43827261 GTGTGTTTGTACATGTGAAAGGG + Intergenic
1024352725 7:48383349-48383371 GTGTGTGTGCATATGTATGTGGG + Intronic
1024369579 7:48565524-48565546 GTGTGTGTGTACCTTTAAACCGG + Intronic
1024534977 7:50422931-50422953 CTGAGTGTGTACATGTAGCTGGG - Intergenic
1024551609 7:50566857-50566879 GTGTGTGTGTGCATGTTAGGAGG + Intergenic
1024854036 7:53755874-53755896 GTGTGTGTGTGCATGTGTCTGGG - Intergenic
1024866702 7:53911548-53911570 GTGTGTGTGTGCATGTGGATGGG - Intergenic
1024872298 7:53978879-53978901 GTGTGTGTGTATATATATATAGG - Intergenic
1026445390 7:70480214-70480236 GTGTGTGTGCACATGCACTTAGG + Intronic
1026527222 7:71164699-71164721 GTGTGTGTGTGCATGTGACAAGG + Intronic
1026607549 7:71828726-71828748 GTGTGTGTGTGTGTGTAATTTGG + Intronic
1026975689 7:74496594-74496616 GTGTGGGTGTGCATGTATGTGGG + Intronic
1027353605 7:77335946-77335968 GTTTGTGTGTACATAAAGCTAGG + Intronic
1027548839 7:79565054-79565076 GTGTGTGTGTATGTGTATGTTGG + Intergenic
1027749190 7:82120199-82120221 GTGTGTGTGTGCATGTGTGTAGG + Intronic
1027880589 7:83830304-83830326 TTTTGTGTGTACAGGTAAATGGG + Intergenic
1027959261 7:84922666-84922688 GTATGTGTGTATATTTAATTTGG + Intergenic
1028221169 7:88198659-88198681 GAGTTTGTGTACCTGTAACTAGG - Intronic
1028492589 7:91429260-91429282 GTATGTGTGTATATGTAACTTGG + Intergenic
1029100235 7:98123690-98123712 GTGTGTGTATATATGAAAATTGG - Intronic
1029108782 7:98200403-98200425 GTGTGAGTGTACTTATAACATGG + Intronic
1029151982 7:98486924-98486946 GTGTGTGCACACATGTATCTGGG + Intergenic
1029373483 7:100164254-100164276 GTGTGTGTGTGCATGTAAGAGGG - Intronic
1029797356 7:102909664-102909686 GTGTGTCTAGAAATGTAACTTGG + Intronic
1029827216 7:103210678-103210700 GTGTGTGTGTGTATGAAACTTGG + Intergenic
1029827220 7:103210743-103210765 GTGTATGTGTGTATGAAACTTGG + Intergenic
1029842534 7:103381565-103381587 GTGTGTGTGTATATGTATGTAGG - Intronic
1030545570 7:110890964-110890986 GTGTGTGTGTATATGTATTTGGG - Intronic
1030657004 7:112179541-112179563 GTTTTTGTGTGCATGTAGCTGGG - Intronic
1031014392 7:116557584-116557606 GTTTGGGTGAACATGTACCTGGG + Intronic
1031275052 7:119711308-119711330 GTGTGTGTGTACATGTAGGAAGG - Intergenic
1031351284 7:120734512-120734534 GTGTTTGTGTATATGAACCTGGG - Intronic
1031854299 7:126903555-126903577 GTGTGTGTGTGTATGTATTTAGG - Intronic
1031977050 7:128100851-128100873 GTGTGTGTGTAGATGCCTCTTGG + Intergenic
1032550965 7:132783897-132783919 GTGTCTATGAACATGTCACTCGG + Intergenic
1032773217 7:135080935-135080957 GTGTGTGTGTGTGTGTAATTAGG - Intronic
1033117376 7:138637529-138637551 GTGTGTGTGTGTATGTATGTAGG - Intronic
1033828955 7:145228822-145228844 ATGTGTGTATACATGTATGTGGG - Intergenic
1033907405 7:146222572-146222594 GTGTGCGTGCACATGTATGTAGG + Intronic
1034009745 7:147516630-147516652 GTGTGTGTGTGTGTGTTACTAGG + Intronic
1034130203 7:148709052-148709074 GTGAGCGTGTATGTGTAACTAGG + Intronic
1034171230 7:149064955-149064977 GTGTGTGTGTGTGTGTAGCTGGG - Intergenic
1034362399 7:150511902-150511924 GTGTGTGTGTGCACAAAACTCGG - Intergenic
1034738911 7:153455268-153455290 GTGTGTGTGTACGTGCAAATAGG - Intergenic
1035330286 7:158092276-158092298 GTGTGTGTGTATATATATGTAGG + Intronic
1035395296 7:158531026-158531048 GTGTGTGTGAACATGTGCATGGG + Intronic
1035925695 8:3725508-3725530 GTGTGTGTGTATGTGTATGTGGG + Intronic
1035946917 8:3974138-3974160 GTGTGTGTCTACATGTACAGAGG + Intronic
1036040766 8:5078140-5078162 GTGTGTGTGTATATATATATAGG - Intergenic
1036216232 8:6882346-6882368 GTGTGTGTGTACGTGCATTTAGG + Intergenic
1037315068 8:17592905-17592927 GTGTGTGTGTGCATGTATGTGGG - Intronic
1037424190 8:18737331-18737353 GTGTGTGTGTGCGTGTGACGGGG + Intronic
1037676363 8:21054147-21054169 GTGTGTGTGTGCAGCTAACAGGG - Intergenic
1038036075 8:23688015-23688037 GTGTGTTTGAAAATGTATCTGGG + Intergenic
1038140035 8:24834323-24834345 GTGTGTGTGTGTGTGTACCTTGG + Intergenic
1038150557 8:24939553-24939575 GTGTGTGTGTACTTGAGACAGGG + Intergenic
1038198642 8:25391235-25391257 GTGTGTGTGTGTGTGTAAATGGG + Intronic
1039763190 8:40600143-40600165 GTGTGTGTATACATGTATTGGGG + Intronic
1039795556 8:40909823-40909845 GTGTGTCTGTTCATGCAACAAGG - Intergenic
1040531000 8:48266253-48266275 GTTTGTGGGAACATGTACCTAGG - Intergenic
1040640474 8:49328578-49328600 GTGTGTGTACACATATAAATAGG - Intergenic
1041738009 8:61132061-61132083 GTGTGAGTGTCCATGTACCGTGG - Intronic
1041814734 8:61957026-61957048 GTGTGTGTGTGTGTTTAACTTGG - Intergenic
1042028163 8:64445865-64445887 GTGTGTGTGTTCATGGAATGGGG + Intergenic
1042279997 8:67045470-67045492 GTGTGTATGTGTGTGTAACTAGG - Intronic
1042741821 8:72057205-72057227 GTGTGTCTGTATGTGTAAGTGGG + Intronic
1042757442 8:72231854-72231876 GTGTGTCTGTATGTGTAAGTGGG + Intergenic
1043059700 8:75484580-75484602 TTTTGTGAGAACATGTAACTGGG - Intronic
1043073624 8:75668137-75668159 GTGTGTGTGTGTATGTATATAGG + Intergenic
1043097617 8:75995476-75995498 GTGTGTGTGTAAGTGTAATGAGG + Intergenic
1043126543 8:76403684-76403706 GTGTGTGTGCATATGTATGTGGG - Intergenic
1043151670 8:76724989-76725011 GTGTGTGTGTACAGGTATATGGG + Intronic
1043541402 8:81267267-81267289 GTGTGTGTGTATATATATATAGG + Intergenic
1043803273 8:84638937-84638959 GTGTGTGTGTACATATATATGGG - Intronic
1044035379 8:87296641-87296663 GTGTGTGTGTCTATATAATTTGG + Intronic
1044476494 8:92632742-92632764 GTGTGTGTGTACATATCTTTAGG + Intergenic
1045051411 8:98330239-98330261 GTGTCTGTGAAAAGGTAACTTGG + Intergenic
1045457465 8:102395419-102395441 GTGTTTGTGTATATGTAAACAGG - Intronic
1045578588 8:103453206-103453228 GTGTGTGCGTGTATTTAACTGGG + Intergenic
1045878386 8:107009772-107009794 GTGTGTGTGTATATGTGTGTGGG - Intergenic
1045931878 8:107636607-107636629 GTGTGTGTGTGTGTGTAGCTGGG - Intergenic
1046405465 8:113767157-113767179 GTGTGTGTGTGTGTGTAAGTGGG + Intergenic
1046697794 8:117361218-117361240 GTGTGTGTGTGTGTGTAACAGGG - Intergenic
1047288348 8:123507471-123507493 GTGTGTGTGTACGTGCACATTGG + Intronic
1047367540 8:124225705-124225727 GTGTGTGTGTATGTGTATCATGG - Intergenic
1047617801 8:126577437-126577459 GTGTGTGTGTATATGTGTGTTGG - Intergenic
1048493724 8:134918353-134918375 CTGTGTGTGTGCATGCAACACGG + Intergenic
1049159497 8:141088253-141088275 GTGTGTGTGTGCATGTGTATGGG - Intergenic
1049525451 8:143123719-143123741 GGGTGTGTGCACATGTATGTGGG - Intergenic
1049525577 8:143125050-143125072 GTGTGTGTGTACATGTTTGAGGG - Intergenic
1049525586 8:143125156-143125178 GTGTGTGTGTACATTTATCAGGG - Intergenic
1049912196 9:279885-279907 GTGTGACTGCACATGTGACTTGG + Intronic
1050287824 9:4121614-4121636 GTGTGTGTGTGTGTGTCACTGGG - Intronic
1050349694 9:4728974-4728996 GTGTGTGTGTATATATATGTAGG - Intronic
1050583852 9:7089666-7089688 GTTTATGGGAACATGTAACTTGG - Intergenic
1050616132 9:7403509-7403531 GTGTCTGTGTGCATGTGACATGG - Intergenic
1050866302 9:10504241-10504263 CTGTTTGTGTACATGTAGATAGG - Intronic
1051087265 9:13364163-13364185 GTGTGTGTGCACGTGTAAACAGG + Intergenic
1051205237 9:14681743-14681765 GTGTGTGTGTGTGTGTAAGTGGG + Intronic
1051470684 9:17437821-17437843 GTGTGTGTGTATATATAACATGG + Intronic
1052042609 9:23756545-23756567 GTGTGTGTTTAAGTGTAATTAGG - Intronic
1052049644 9:23830595-23830617 GTGTGTGTGTGTGTGTAAGTGGG - Intergenic
1052686873 9:31768063-31768085 GTGTGTGTGTAAGTGTAAAATGG - Intergenic
1053183839 9:35997540-35997562 GTGTGTGTGTACGTGTTATAAGG + Intergenic
1053485525 9:38452105-38452127 GTGTGTGTGCACATGTACCTGGG - Intergenic
1053512570 9:38701159-38701181 GTGTGTGTGTATGTGTACATTGG + Intergenic
1053874236 9:42526346-42526368 GTGTGTGTGTACATGTGTGTGGG + Intergenic
1054268097 9:62940408-62940430 GTGTGTGTGTACATGTGTGTGGG - Intergenic
1054907057 9:70420825-70420847 GTATGTGTGGAAATGAAACTGGG - Intergenic
1055024528 9:71705809-71705831 GTGTGTGTGTATATATATATAGG + Intronic
1055055818 9:72022976-72022998 GTGTGTGTGTGTGTGTAGCTTGG - Intergenic
1055111585 9:72565567-72565589 GTGTGTGTGTATGTGTATGTTGG + Intronic
1055177227 9:73334903-73334925 GTGTATGTGTACAGATAAATAGG - Intergenic
1056024297 9:82476873-82476895 TTGTTTGTGTACATGTATTTGGG + Intergenic
1056450128 9:86708826-86708848 GTGTGTGTGTGTGTGTAACACGG + Intergenic
1056779663 9:89539692-89539714 GTGTGTGTGTGCATGTCTGTGGG + Intergenic
1056804345 9:89717168-89717190 GTGTGTGAGTATATGTATGTGGG - Intergenic
1056904979 9:90638652-90638674 GTGTGTGTGTGCACGTAATTGGG + Intronic
1057202971 9:93152896-93152918 GTGTGTTTATCCATGTACCTGGG + Intergenic
1057523709 9:95781488-95781510 GTGTGTGTGTGCATGTATTGGGG - Intergenic
1057754346 9:97819931-97819953 GTGTGTGTGTAGGTGGGACTTGG + Intergenic
1059710235 9:116861208-116861230 GTGTGTGTGTGTGTGTAGCTTGG - Intronic
1059868589 9:118545559-118545581 ATGTGTGTGTACAGGTAAAGTGG - Intergenic
1059967445 9:119629315-119629337 GTGTGTGTATAAATGTATATGGG + Intergenic
1060116587 9:120946190-120946212 GTGTGTATGTGCATGTTTCTGGG + Intergenic
1060575507 9:124688810-124688832 GTGTTTATGTACATGTATTTAGG + Intronic
1060942210 9:127549470-127549492 GTGTGAGTGTACATGTGTGTGGG - Intronic
1061209963 9:129185667-129185689 GTGTGTGTGTGCATGTGTGTGGG - Intergenic
1062257076 9:135631393-135631415 GTTTGTGTGTGCATGTAAACAGG + Intronic
1203526315 Un_GL000213v1:92338-92360 GTGTGTGTGTGTGTGTGACTAGG - Intergenic
1185589824 X:1268631-1268653 GTGTGTGTGTAGATGTGTGTGGG + Intergenic
1185615129 X:1417112-1417134 GTGTCTGTGTGCATGTGTCTGGG - Intronic
1186132874 X:6487698-6487720 GTGTGTGTGTGTGTGTAATTAGG - Intergenic
1186380911 X:9057958-9057980 GTGTGTGTGCACTTGTAACTGGG + Intronic
1186616118 X:11189815-11189837 CTGTTTGTATACATGTACCTTGG + Intronic
1186769989 X:12808300-12808322 GTGTGTGTGTGTGTGTAACAAGG + Intronic
1187348715 X:18491984-18492006 GTGTGTGTGTATGTGTTTCTGGG + Intronic
1187492888 X:19768897-19768919 GTGTGTGTGTACACTGAATTTGG - Intronic
1188312580 X:28635801-28635823 GTGTGTGTGTATGTGTAGCCCGG + Intronic
1189050410 X:37639236-37639258 GTATGTGTGTATATGTATGTAGG - Intronic
1189135904 X:38549693-38549715 GTGTGTGTGTATCTCCAACTTGG + Intronic
1190254942 X:48755275-48755297 CTGTGTGTGTACATGTGGTTGGG - Intergenic
1190709559 X:53056929-53056951 GTGTATTTCTACATGTAAGTTGG + Intronic
1192185489 X:68944181-68944203 GTGTGTGAGTAACTGTAGCTGGG + Intergenic
1193467126 X:81863911-81863933 GTGTGTGTGTATATATATATGGG + Intergenic
1193867456 X:86753043-86753065 GTGTGTGTGTACTTTTAATAAGG - Intronic
1193987931 X:88269609-88269631 GTGTGTGTGTGTATGGTACTGGG + Intergenic
1194592723 X:95819204-95819226 GTGTGTGTGTGTGTGTAAATGGG - Intergenic
1195485357 X:105398492-105398514 GTGTGTGTGTGTATGTAATTAGG + Intronic
1195563671 X:106316190-106316212 GTGTGTGTGTGCATGCATTTAGG - Intergenic
1195782791 X:108483237-108483259 GTGTGTGTGTGTATGTAAAGGGG + Intronic
1196110825 X:111945500-111945522 GTGTGTGTGTCTATGTATGTCGG - Intronic
1197423062 X:126262196-126262218 GTGTGTGTGTGTGTGCAACTGGG + Intergenic
1197604928 X:128574479-128574501 TTGTGTGTGTATATGAAACCAGG - Intergenic
1197621621 X:128756800-128756822 GTGTGTGTGTATATATATATAGG + Intergenic
1198700527 X:139392651-139392673 GTGTGTGTGCACATGGAAGGAGG - Intergenic
1198773399 X:140154552-140154574 GTGTGTGTGTCATTGTAAATGGG - Intergenic
1198778943 X:140213903-140213925 GTGTGTGTGTGTATGTATCCAGG - Intergenic
1198855347 X:141009900-141009922 GTGTGTGTGTATATAAATCTCGG - Intergenic
1199320336 X:146430686-146430708 GTGTGTGTGTGCGTGCAACAAGG + Intergenic
1199325235 X:146491030-146491052 GTGTGTGTGTGTGTGTATCTGGG - Intergenic
1199416282 X:147586709-147586731 GTATGTGTGTGCATTTATCTGGG + Intergenic
1199868276 X:151873896-151873918 GTGTGCGTGTGCATGCATCTGGG + Intergenic
1199881594 X:151977714-151977736 GTGTGTGTGTGCATGTGTGTGGG + Intergenic
1200371727 X:155733268-155733290 GTGTGTGTGTATATATATATAGG - Intergenic
1200939709 Y:8768835-8768857 GTGTGTGTGTGACTATAACTAGG - Intergenic
1200961713 Y:9001938-9001960 GTGTGTGTGTGCCTGTAAGTGGG + Intergenic
1200982192 Y:9272571-9272593 GTGCGTGTGTGCCTGTAAGTGGG - Intergenic
1201506504 Y:14707155-14707177 GTGTGTGTGTAGAAGTTATTAGG + Intronic
1202128220 Y:21587156-21587178 GTGTGTGTGTGCCTGTAAGTGGG + Intergenic
1202302867 Y:23436057-23436079 GAATGTGTGTATATATAACTTGG + Intergenic
1202567944 Y:26234537-26234559 GAATGTGTGTATATATAACTTGG - Intergenic