ID: 1010001732

View in Genome Browser
Species Human (GRCh38)
Location 6:70956039-70956061
Sequence CGAGCTGGTGAGCCGCTTCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 101}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010001732_1010001740 28 Left 1010001732 6:70956039-70956061 CCAGGAAGCGGCTCACCAGCTCG 0: 1
1: 0
2: 0
3: 4
4: 101
Right 1010001740 6:70956090-70956112 TCCAGTGCAGCTGCGCCACCTGG 0: 1
1: 0
2: 0
3: 14
4: 179
1010001732_1010001734 4 Left 1010001732 6:70956039-70956061 CCAGGAAGCGGCTCACCAGCTCG 0: 1
1: 0
2: 0
3: 4
4: 101
Right 1010001734 6:70956066-70956088 GCGCCGCCGCGTCCTCCACCAGG 0: 1
1: 0
2: 3
3: 17
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010001732 Original CRISPR CGAGCTGGTGAGCCGCTTCC TGG (reversed) Exonic
906137193 1:43507820-43507842 CCAGCTGGTGAGCAGATGCCAGG - Intergenic
907046987 1:51305462-51305484 CCAGCTGGGGAGGGGCTTCCAGG - Intronic
912556197 1:110517914-110517936 CGAGCTGGTGCTCCGGTTCGTGG - Exonic
913231122 1:116741518-116741540 CCAGCTGCTGAGTGGCTTCCTGG + Intergenic
915164766 1:153942336-153942358 AGAGCTGCTGGGCCGCTACCCGG - Exonic
920291987 1:204929700-204929722 GGAGCTGGGGAGTCGCTCCCTGG + Intronic
1065940398 10:30559204-30559226 GAAGCTGGTGATCAGCTTCCTGG + Intergenic
1070427488 10:76303842-76303864 CGAGCGTGTTAGCCGCTGCCTGG - Intronic
1071085714 10:81866755-81866777 CTTGGTGGTGAGCCACTTCCTGG - Intergenic
1072555747 10:96512863-96512885 CGTCCTGGGGCGCCGCTTCCTGG + Intronic
1073205906 10:101769185-101769207 CGAGGTGGGCAGCCTCTTCCTGG + Intergenic
1076104717 10:127812334-127812356 GGAGCTGGAGAGAGGCTTCCTGG - Intergenic
1076558525 10:131345896-131345918 CGTGCTGGCGAGCTTCTTCCAGG - Intergenic
1076863937 10:133158260-133158282 AGAGCTGGTGAGCAGCTTCTGGG - Intergenic
1076996763 11:300891-300913 CGAAGTGGGGAGGCGCTTCCCGG + Intergenic
1077048486 11:556248-556270 GCAGCTGGTGCGCGGCTTCCCGG - Exonic
1081968239 11:47182481-47182503 GGACCTGGTCAGCTGCTTCCAGG - Exonic
1082091828 11:48096638-48096660 AGAGCTGTTGAGGCCCTTCCTGG + Intronic
1082114305 11:48311541-48311563 TGAGCTGGGGACCTGCTTCCTGG + Intergenic
1083285825 11:61658203-61658225 CAGGCTGCTGAGACGCTTCCTGG + Intergenic
1084857579 11:71998842-71998864 CGAGCTTGTGTGCCAGTTCCTGG + Intronic
1085025603 11:73234726-73234748 CGAGCTCTTCAGCCGCTTCGTGG + Exonic
1088532136 11:110821831-110821853 CCAGCTGCTGAGCTGCTTGCAGG + Intergenic
1089461980 11:118658967-118658989 CCAGCTGGAAAGCCACTTCCTGG + Exonic
1095270895 12:40217407-40217429 CTAGATTGTGAGCCGCTTCAGGG + Intronic
1101604789 12:106239833-106239855 CGAGCTGGTGAGCCTCAAGCAGG - Exonic
1104901404 12:132191220-132191242 CAGGCTGGTGAGCCGGTGCCTGG + Intergenic
1105828984 13:24147562-24147584 CAAGCTGTTAAGCCCCTTCCAGG + Intronic
1106168687 13:27270869-27270891 CCAGCTGGCGAGCCGGCTCCGGG + Exonic
1112504646 13:99968648-99968670 CGGGCTGGGGAGCGGCTTCACGG + Intronic
1113892611 13:113744262-113744284 GCAGCTGGTGAGCCACTCCCTGG - Intergenic
1118025313 14:61762496-61762518 GGCGCTGCTCAGCCGCTTCCAGG + Exonic
1121694942 14:95904693-95904715 AGAGGTGGGGAGCCCCTTCCAGG + Intergenic
1125524681 15:40367546-40367568 GGAGCTGCTGAGGCACTTCCTGG + Exonic
1129235927 15:74223663-74223685 CGAGCAGGTCAGCCCCGTCCAGG + Intergenic
1131117244 15:89802966-89802988 GGAGCTGTAGAGCCCCTTCCTGG - Intronic
1132568489 16:634030-634052 CGAGCTGCTCAACCGCTTCCAGG + Exonic
1134680546 16:16122013-16122035 CGAGTCGGTCAGCCGCTCCCCGG + Exonic
1136516031 16:30768843-30768865 TGAGCTGCGGAGCCGCATCCGGG + Exonic
1141420815 16:83914367-83914389 CGAGCAGCAGAGCAGCTTCCGGG + Intronic
1141815798 16:86408534-86408556 CGAGCCGGTGACCTGCTTCAGGG + Intergenic
1142292572 16:89199756-89199778 GGAGCAGGTGAGCCACCTCCTGG - Exonic
1147557635 17:41489486-41489508 GGAGCTGGAGAGCCGCATCCAGG - Exonic
1148460745 17:47837879-47837901 GGAGCTGGGCAGCCTCTTCCAGG - Exonic
1152259602 17:79259969-79259991 CCAGATGCTGAGCCCCTTCCTGG + Intronic
1152820691 17:82436225-82436247 CGAGCTGCTGAGCGCCTTTCTGG + Intronic
1152829877 17:82490696-82490718 AGGCCTGGTGAGCAGCTTCCTGG - Intergenic
1157815930 18:50729542-50729564 CGAGCCGGCCAGCCTCTTCCTGG + Exonic
1160937794 19:1605391-1605413 CGCGATGGTGACCCGGTTCCTGG - Exonic
1161060731 19:2213556-2213578 GGAGCTGCTGAGCCGCACCCAGG - Exonic
1161105528 19:2441925-2441947 CGAGTTGCTGAGGAGCTTCCCGG - Intronic
1161699625 19:5787645-5787667 CGAGCTGCTGAGCCGCACCGTGG - Exonic
1161723256 19:5915092-5915114 CGAGGTGCTGCGCCGCTTCCTGG + Exonic
1162198973 19:9007623-9007645 TGCGCTGCTGAGCCCCTTCCTGG - Intergenic
1162418467 19:10552411-10552433 AGAGCTGGGGTGCTGCTTCCAGG + Intronic
1167233416 19:48298947-48298969 CGAGCTGGAGAGCCTCCTCGGGG - Intronic
929342915 2:40844612-40844634 AGGGCTGGTGAGCTACTTCCTGG + Intergenic
937066847 2:119024008-119024030 GTAGCTGGTCAGCCTCTTCCAGG + Intergenic
944271722 2:197791131-197791153 CCAGCTGGTGAGCCTCTTAATGG - Intergenic
946427653 2:219608075-219608097 GGAGCTCATGAGCAGCTTCCGGG + Exonic
1168826524 20:818139-818161 TGGGCAGGTGAGCAGCTTCCAGG + Intergenic
1171400968 20:24872824-24872846 AGAGCTGGTGAGCAGCTGGCTGG + Intergenic
1173618678 20:44419794-44419816 CGAGCTGGTGCTGCCCTTCCAGG + Exonic
1176215671 20:63946565-63946587 CTGGCTGGTGGTCCGCTTCCGGG + Exonic
1176448241 21:6840375-6840397 CAAGCTGGAGAGGTGCTTCCCGG + Intergenic
1176826411 21:13705397-13705419 CAAGCTGGAGAGGTGCTTCCCGG + Intergenic
1180127467 21:45802180-45802202 CCAGCTGCAGAGCCGCTACCAGG - Intronic
1180931052 22:19591813-19591835 GGAGCTGGTGGGTCACTTCCTGG + Intergenic
1184175368 22:42785952-42785974 CGAGCTGCAGAGCGGCTTCAAGG + Intergenic
1185373782 22:50472862-50472884 TGAGCTGGTCAGCTGCTTGCTGG - Intronic
950983198 3:17331184-17331206 CGAGATGGTAAGGCTCTTCCTGG + Intronic
952738733 3:36715492-36715514 AGATCTGGTGAGCCGGTTGCTGG - Exonic
954895942 3:53974802-53974824 AGAGCAGGTGAGACCCTTCCTGG - Intergenic
966628547 3:182046578-182046600 CAGGCCTGTGAGCCGCTTCCAGG + Intergenic
967761038 3:193226610-193226632 CCAGCTGGAGAGCTTCTTCCAGG - Intergenic
969361983 4:6670349-6670371 TGTGCTGCTGAGCCACTTCCAGG - Intergenic
971135235 4:23861325-23861347 TGAGCTGTTGAGCAGCTTCTGGG - Intronic
979260496 4:118638807-118638829 CGAGGAGGTGAGCCCCTGCCAGG - Intergenic
985927082 5:3027067-3027089 CAAGCTGGTGAGGGGCTCCCTGG - Intergenic
992726296 5:79611416-79611438 CGATCTGGTGAGGGGCTTCTCGG - Intergenic
998370324 5:141656557-141656579 CTTGCTGGGAAGCCGCTTCCAGG - Exonic
1001817118 5:174678885-174678907 CTTACTGGTGAGCCCCTTCCTGG - Intergenic
1004682285 6:17907981-17908003 CGCACTGGTGAGCCTCTGCCTGG + Intronic
1010001732 6:70956039-70956061 CGAGCTGGTGAGCCGCTTCCTGG - Exonic
1013099687 6:106975575-106975597 GGAGCTGGGGAGCCGCTCGCTGG + Intronic
1018837441 6:167496005-167496027 GCATCTGGTGAGCCGCCTCCCGG + Intergenic
1019014728 6:168871680-168871702 TGAGCAGGTGTGCGGCTTCCAGG - Intergenic
1029406106 7:100374788-100374810 AGAGCGGGTGAGCCACATCCTGG - Intronic
1029610562 7:101624480-101624502 AGAGCTGGACAGCTGCTTCCTGG + Intronic
1035719795 8:1783434-1783456 CAAGCTGGAGAGCCACATCCTGG - Exonic
1037535191 8:19817280-19817302 AGAGCAGTTGAACCGCTTCCAGG - Exonic
1040951825 8:52945073-52945095 GAAGATGGTGAGCCGCTCCCTGG - Intergenic
1050401931 9:5265789-5265811 TGAGCAGGTGAGCAGCCTCCTGG + Intergenic
1052867540 9:33473808-33473830 CCAGCTGGAGAGCAGCTTCGCGG - Exonic
1057472347 9:95368917-95368939 CCAGCAGGTGGGCCGCCTCCCGG + Intergenic
1061082797 9:128382284-128382306 AGAGCTGGTTAGCAGCTGCCAGG + Intronic
1062279113 9:135744149-135744171 GGAGCTGGTGTGGAGCTTCCCGG + Intronic
1062396839 9:136356013-136356035 CGGGCTGATGACACGCTTCCCGG - Intronic
1062651390 9:137579473-137579495 CCACCTGCTGAGCCGCTTCTGGG - Intergenic
1203520950 Un_GL000213v1:44143-44165 CAAGCTGGAGAGGTGCTTCCCGG - Intergenic
1186669711 X:11757217-11757239 CGGGCTGGAGACCAGCTTCCAGG - Intergenic
1188811310 X:34656942-34656964 CGGGCTGGTGTGCATCTTCCTGG - Exonic
1190148283 X:47918749-47918771 TGAGCTGGGGAGCCGTTCCCAGG + Exonic
1192230457 X:69261057-69261079 CGAGCTGGTGAAGCCCTCCCTGG + Intergenic
1199698818 X:150362154-150362176 CGAGCTGGTGAGCGGATGCGTGG + Intronic
1201895952 Y:18993024-18993046 GGAGCTGGGGAGCCGCTCGCTGG + Intergenic