ID: 1010003259

View in Genome Browser
Species Human (GRCh38)
Location 6:70969344-70969366
Sequence TTTCAGAGGGGCATCTGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010003259_1010003265 5 Left 1010003259 6:70969344-70969366 CCAGGTCAGATGCCCCTCTGAAA No data
Right 1010003265 6:70969372-70969394 AAGCAGGATGAAAAGAGCAGAGG No data
1010003259_1010003268 23 Left 1010003259 6:70969344-70969366 CCAGGTCAGATGCCCCTCTGAAA No data
Right 1010003268 6:70969390-70969412 AGAGGAGGCAGAGTCTCTGTGGG No data
1010003259_1010003266 8 Left 1010003259 6:70969344-70969366 CCAGGTCAGATGCCCCTCTGAAA No data
Right 1010003266 6:70969375-70969397 CAGGATGAAAAGAGCAGAGGAGG No data
1010003259_1010003269 28 Left 1010003259 6:70969344-70969366 CCAGGTCAGATGCCCCTCTGAAA No data
Right 1010003269 6:70969395-70969417 AGGCAGAGTCTCTGTGGGACTGG No data
1010003259_1010003267 22 Left 1010003259 6:70969344-70969366 CCAGGTCAGATGCCCCTCTGAAA No data
Right 1010003267 6:70969389-70969411 CAGAGGAGGCAGAGTCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010003259 Original CRISPR TTTCAGAGGGGCATCTGACC TGG (reversed) Intergenic
No off target data available for this crispr