ID: 1010003834

View in Genome Browser
Species Human (GRCh38)
Location 6:70974315-70974337
Sequence GAGGGCAAACTGAAGCAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010003825_1010003834 24 Left 1010003825 6:70974268-70974290 CCTGGTTCATCTCAATGGGACTG 0: 28
1: 736
2: 962
3: 1196
4: 778
Right 1010003834 6:70974315-70974337 GAGGGCAAACTGAAGCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010003834 Original CRISPR GAGGGCAAACTGAAGCAGGG TGG Intergenic
No off target data available for this crispr