ID: 1010003834 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:70974315-70974337 |
Sequence | GAGGGCAAACTGAAGCAGGG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1010003825_1010003834 | 24 | Left | 1010003825 | 6:70974268-70974290 | CCTGGTTCATCTCAATGGGACTG | 0: 28 1: 736 2: 962 3: 1196 4: 778 |
||
Right | 1010003834 | 6:70974315-70974337 | GAGGGCAAACTGAAGCAGGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1010003834 | Original CRISPR | GAGGGCAAACTGAAGCAGGG TGG | Intergenic | ||
No off target data available for this crispr |