ID: 1010011428

View in Genome Browser
Species Human (GRCh38)
Location 6:71051864-71051886
Sequence CTCAAGAGTGTACAGCCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010011428_1010011433 -8 Left 1010011428 6:71051864-71051886 CCCTGGGGCTGTACACTCTTGAG No data
Right 1010011433 6:71051879-71051901 CTCTTGAGGGCATGGATTGCAGG No data
1010011428_1010011435 -6 Left 1010011428 6:71051864-71051886 CCCTGGGGCTGTACACTCTTGAG No data
Right 1010011435 6:71051881-71051903 CTTGAGGGCATGGATTGCAGGGG No data
1010011428_1010011434 -7 Left 1010011428 6:71051864-71051886 CCCTGGGGCTGTACACTCTTGAG No data
Right 1010011434 6:71051880-71051902 TCTTGAGGGCATGGATTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010011428 Original CRISPR CTCAAGAGTGTACAGCCCCA GGG (reversed) Intergenic