ID: 1010011435

View in Genome Browser
Species Human (GRCh38)
Location 6:71051881-71051903
Sequence CTTGAGGGCATGGATTGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010011421_1010011435 18 Left 1010011421 6:71051840-71051862 CCTCTTTATCCCGAGTGACATCC No data
Right 1010011435 6:71051881-71051903 CTTGAGGGCATGGATTGCAGGGG No data
1010011420_1010011435 26 Left 1010011420 6:71051832-71051854 CCAAGGCACCTCTTTATCCCGAG No data
Right 1010011435 6:71051881-71051903 CTTGAGGGCATGGATTGCAGGGG No data
1010011424_1010011435 9 Left 1010011424 6:71051849-71051871 CCCGAGTGACATCCTCCCTGGGG No data
Right 1010011435 6:71051881-71051903 CTTGAGGGCATGGATTGCAGGGG No data
1010011426_1010011435 8 Left 1010011426 6:71051850-71051872 CCGAGTGACATCCTCCCTGGGGC No data
Right 1010011435 6:71051881-71051903 CTTGAGGGCATGGATTGCAGGGG No data
1010011427_1010011435 -3 Left 1010011427 6:71051861-71051883 CCTCCCTGGGGCTGTACACTCTT No data
Right 1010011435 6:71051881-71051903 CTTGAGGGCATGGATTGCAGGGG No data
1010011428_1010011435 -6 Left 1010011428 6:71051864-71051886 CCCTGGGGCTGTACACTCTTGAG No data
Right 1010011435 6:71051881-71051903 CTTGAGGGCATGGATTGCAGGGG No data
1010011429_1010011435 -7 Left 1010011429 6:71051865-71051887 CCTGGGGCTGTACACTCTTGAGG No data
Right 1010011435 6:71051881-71051903 CTTGAGGGCATGGATTGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010011435 Original CRISPR CTTGAGGGCATGGATTGCAG GGG Intergenic