ID: 1010012008

View in Genome Browser
Species Human (GRCh38)
Location 6:71058728-71058750
Sequence GTCAGCCAAATGTTCATTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010012003_1010012008 9 Left 1010012003 6:71058696-71058718 CCCTGGGAGCCACTCTGCATTCT No data
Right 1010012008 6:71058728-71058750 GTCAGCCAAATGTTCATTTTGGG No data
1010012002_1010012008 14 Left 1010012002 6:71058691-71058713 CCTTTCCCTGGGAGCCACTCTGC No data
Right 1010012008 6:71058728-71058750 GTCAGCCAAATGTTCATTTTGGG No data
1010012001_1010012008 15 Left 1010012001 6:71058690-71058712 CCCTTTCCCTGGGAGCCACTCTG No data
Right 1010012008 6:71058728-71058750 GTCAGCCAAATGTTCATTTTGGG No data
1010012004_1010012008 8 Left 1010012004 6:71058697-71058719 CCTGGGAGCCACTCTGCATTCTG No data
Right 1010012008 6:71058728-71058750 GTCAGCCAAATGTTCATTTTGGG No data
1010012000_1010012008 16 Left 1010012000 6:71058689-71058711 CCCCTTTCCCTGGGAGCCACTCT No data
Right 1010012008 6:71058728-71058750 GTCAGCCAAATGTTCATTTTGGG No data
1010012006_1010012008 0 Left 1010012006 6:71058705-71058727 CCACTCTGCATTCTGGCTAAGCT No data
Right 1010012008 6:71058728-71058750 GTCAGCCAAATGTTCATTTTGGG No data
1010011999_1010012008 17 Left 1010011999 6:71058688-71058710 CCCCCTTTCCCTGGGAGCCACTC No data
Right 1010012008 6:71058728-71058750 GTCAGCCAAATGTTCATTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010012008 Original CRISPR GTCAGCCAAATGTTCATTTT GGG Intergenic
No off target data available for this crispr