ID: 1010016100

View in Genome Browser
Species Human (GRCh38)
Location 6:71106214-71106236
Sequence CTGGCTTCACACACCTCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010016100_1010016104 -2 Left 1010016100 6:71106214-71106236 CCATGAGAGGTGTGTGAAGCCAG No data
Right 1010016104 6:71106235-71106257 AGGGATTATATGACCTGAATTGG No data
1010016100_1010016105 1 Left 1010016100 6:71106214-71106236 CCATGAGAGGTGTGTGAAGCCAG No data
Right 1010016105 6:71106238-71106260 GATTATATGACCTGAATTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010016100 Original CRISPR CTGGCTTCACACACCTCTCA TGG (reversed) Intergenic
No off target data available for this crispr