ID: 1010016293

View in Genome Browser
Species Human (GRCh38)
Location 6:71108275-71108297
Sequence CAGAGGAAGGAGCAGGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010016293_1010016298 21 Left 1010016293 6:71108275-71108297 CCTGCCTCCTGCTCCTTCCTCTG No data
Right 1010016298 6:71108319-71108341 GCTGAGAAATGATTACAAGTTGG No data
1010016293_1010016300 30 Left 1010016293 6:71108275-71108297 CCTGCCTCCTGCTCCTTCCTCTG No data
Right 1010016300 6:71108328-71108350 TGATTACAAGTTGGACAGAAGGG No data
1010016293_1010016299 29 Left 1010016293 6:71108275-71108297 CCTGCCTCCTGCTCCTTCCTCTG No data
Right 1010016299 6:71108327-71108349 ATGATTACAAGTTGGACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010016293 Original CRISPR CAGAGGAAGGAGCAGGAGGC AGG (reversed) Intergenic
No off target data available for this crispr