ID: 1010016298

View in Genome Browser
Species Human (GRCh38)
Location 6:71108319-71108341
Sequence GCTGAGAAATGATTACAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010016297_1010016298 4 Left 1010016297 6:71108292-71108314 CCTCTGCTGAAAGTAAAAGCTAA No data
Right 1010016298 6:71108319-71108341 GCTGAGAAATGATTACAAGTTGG No data
1010016296_1010016298 8 Left 1010016296 6:71108288-71108310 CCTTCCTCTGCTGAAAGTAAAAG No data
Right 1010016298 6:71108319-71108341 GCTGAGAAATGATTACAAGTTGG No data
1010016294_1010016298 17 Left 1010016294 6:71108279-71108301 CCTCCTGCTCCTTCCTCTGCTGA No data
Right 1010016298 6:71108319-71108341 GCTGAGAAATGATTACAAGTTGG No data
1010016293_1010016298 21 Left 1010016293 6:71108275-71108297 CCTGCCTCCTGCTCCTTCCTCTG No data
Right 1010016298 6:71108319-71108341 GCTGAGAAATGATTACAAGTTGG No data
1010016295_1010016298 14 Left 1010016295 6:71108282-71108304 CCTGCTCCTTCCTCTGCTGAAAG No data
Right 1010016298 6:71108319-71108341 GCTGAGAAATGATTACAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010016298 Original CRISPR GCTGAGAAATGATTACAAGT TGG Intergenic
No off target data available for this crispr