ID: 1010016299

View in Genome Browser
Species Human (GRCh38)
Location 6:71108327-71108349
Sequence ATGATTACAAGTTGGACAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010016293_1010016299 29 Left 1010016293 6:71108275-71108297 CCTGCCTCCTGCTCCTTCCTCTG No data
Right 1010016299 6:71108327-71108349 ATGATTACAAGTTGGACAGAAGG No data
1010016294_1010016299 25 Left 1010016294 6:71108279-71108301 CCTCCTGCTCCTTCCTCTGCTGA No data
Right 1010016299 6:71108327-71108349 ATGATTACAAGTTGGACAGAAGG No data
1010016296_1010016299 16 Left 1010016296 6:71108288-71108310 CCTTCCTCTGCTGAAAGTAAAAG No data
Right 1010016299 6:71108327-71108349 ATGATTACAAGTTGGACAGAAGG No data
1010016297_1010016299 12 Left 1010016297 6:71108292-71108314 CCTCTGCTGAAAGTAAAAGCTAA No data
Right 1010016299 6:71108327-71108349 ATGATTACAAGTTGGACAGAAGG No data
1010016295_1010016299 22 Left 1010016295 6:71108282-71108304 CCTGCTCCTTCCTCTGCTGAAAG No data
Right 1010016299 6:71108327-71108349 ATGATTACAAGTTGGACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010016299 Original CRISPR ATGATTACAAGTTGGACAGA AGG Intergenic
No off target data available for this crispr