ID: 1010020166

View in Genome Browser
Species Human (GRCh38)
Location 6:71150211-71150233
Sequence AACAGGGCTTTGAGCGTCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010020166_1010020175 23 Left 1010020166 6:71150211-71150233 CCCATGACGCTCAAAGCCCTGTT No data
Right 1010020175 6:71150257-71150279 CATTTATAAATAAATTTTATGGG No data
1010020166_1010020170 -9 Left 1010020166 6:71150211-71150233 CCCATGACGCTCAAAGCCCTGTT No data
Right 1010020170 6:71150225-71150247 AGCCCTGTTGGGATTCTGATTGG No data
1010020166_1010020174 22 Left 1010020166 6:71150211-71150233 CCCATGACGCTCAAAGCCCTGTT No data
Right 1010020174 6:71150256-71150278 CCATTTATAAATAAATTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010020166 Original CRISPR AACAGGGCTTTGAGCGTCAT GGG (reversed) Intergenic
No off target data available for this crispr