ID: 1010022042

View in Genome Browser
Species Human (GRCh38)
Location 6:71171423-71171445
Sequence GAGTCAAAGCCAGGATGACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010022042_1010022046 23 Left 1010022042 6:71171423-71171445 CCACGTCATCCTGGCTTTGACTC No data
Right 1010022046 6:71171469-71171491 TTTCAGCAATGTTACATAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010022042 Original CRISPR GAGTCAAAGCCAGGATGACG TGG (reversed) Intergenic
No off target data available for this crispr