ID: 1010022064

View in Genome Browser
Species Human (GRCh38)
Location 6:71171872-71171894
Sequence CAAGGCAAGCAGAAGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010022064_1010022070 13 Left 1010022064 6:71171872-71171894 CCTTCTTCCTTCTGCTTGCCTTG No data
Right 1010022070 6:71171908-71171930 TCTGTTTTTCTAGGTTTTTGAGG No data
1010022064_1010022071 16 Left 1010022064 6:71171872-71171894 CCTTCTTCCTTCTGCTTGCCTTG No data
Right 1010022071 6:71171911-71171933 GTTTTTCTAGGTTTTTGAGGTGG No data
1010022064_1010022072 17 Left 1010022064 6:71171872-71171894 CCTTCTTCCTTCTGCTTGCCTTG No data
Right 1010022072 6:71171912-71171934 TTTTTCTAGGTTTTTGAGGTGGG No data
1010022064_1010022069 4 Left 1010022064 6:71171872-71171894 CCTTCTTCCTTCTGCTTGCCTTG No data
Right 1010022069 6:71171899-71171921 TATTTGCTTTCTGTTTTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010022064 Original CRISPR CAAGGCAAGCAGAAGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr