ID: 1010022069

View in Genome Browser
Species Human (GRCh38)
Location 6:71171899-71171921
Sequence TATTTGCTTTCTGTTTTTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010022063_1010022069 23 Left 1010022063 6:71171853-71171875 CCTGCTCTTATCTTTATTACCTT No data
Right 1010022069 6:71171899-71171921 TATTTGCTTTCTGTTTTTCTAGG No data
1010022064_1010022069 4 Left 1010022064 6:71171872-71171894 CCTTCTTCCTTCTGCTTGCCTTG No data
Right 1010022069 6:71171899-71171921 TATTTGCTTTCTGTTTTTCTAGG No data
1010022067_1010022069 -3 Left 1010022067 6:71171879-71171901 CCTTCTGCTTGCCTTGGGTTTAT No data
Right 1010022069 6:71171899-71171921 TATTTGCTTTCTGTTTTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010022069 Original CRISPR TATTTGCTTTCTGTTTTTCT AGG Intergenic
No off target data available for this crispr