ID: 1010022071

View in Genome Browser
Species Human (GRCh38)
Location 6:71171911-71171933
Sequence GTTTTTCTAGGTTTTTGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010022064_1010022071 16 Left 1010022064 6:71171872-71171894 CCTTCTTCCTTCTGCTTGCCTTG No data
Right 1010022071 6:71171911-71171933 GTTTTTCTAGGTTTTTGAGGTGG No data
1010022068_1010022071 -2 Left 1010022068 6:71171890-71171912 CCTTGGGTTTATTTGCTTTCTGT No data
Right 1010022071 6:71171911-71171933 GTTTTTCTAGGTTTTTGAGGTGG No data
1010022067_1010022071 9 Left 1010022067 6:71171879-71171901 CCTTCTGCTTGCCTTGGGTTTAT No data
Right 1010022071 6:71171911-71171933 GTTTTTCTAGGTTTTTGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010022071 Original CRISPR GTTTTTCTAGGTTTTTGAGG TGG Intergenic
No off target data available for this crispr