ID: 1010024848

View in Genome Browser
Species Human (GRCh38)
Location 6:71203300-71203322
Sequence CAGGATGAGCGACCTCATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010024848_1010024851 13 Left 1010024848 6:71203300-71203322 CCTTGATGAGGTCGCTCATCCTG No data
Right 1010024851 6:71203336-71203358 TTGTTGATAGTGTATTGGCAAGG No data
1010024848_1010024852 26 Left 1010024848 6:71203300-71203322 CCTTGATGAGGTCGCTCATCCTG No data
Right 1010024852 6:71203349-71203371 ATTGGCAAGGACAAATGCCAAGG No data
1010024848_1010024850 8 Left 1010024848 6:71203300-71203322 CCTTGATGAGGTCGCTCATCCTG No data
Right 1010024850 6:71203331-71203353 TTGCTTTGTTGATAGTGTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010024848 Original CRISPR CAGGATGAGCGACCTCATCA AGG (reversed) Intergenic
No off target data available for this crispr