ID: 1010027711

View in Genome Browser
Species Human (GRCh38)
Location 6:71239165-71239187
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010027705_1010027711 18 Left 1010027705 6:71239124-71239146 CCAGGCTGTCAGCTTTAAGTGAG No data
Right 1010027711 6:71239165-71239187 CAGGGAGGCCGTATAGCATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010027711 Original CRISPR CAGGGAGGCCGTATAGCATA AGG Intergenic
No off target data available for this crispr