ID: 1010038194

View in Genome Browser
Species Human (GRCh38)
Location 6:71350978-71351000
Sequence CTTTCCTTGTAGAAGAGTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010038194_1010038196 -2 Left 1010038194 6:71350978-71351000 CCCTAACTCTTCTACAAGGAAAG No data
Right 1010038196 6:71350999-71351021 AGAAGCATAGCCTGTCTGCTTGG No data
1010038194_1010038198 9 Left 1010038194 6:71350978-71351000 CCCTAACTCTTCTACAAGGAAAG No data
Right 1010038198 6:71351010-71351032 CTGTCTGCTTGGTGACTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010038194 Original CRISPR CTTTCCTTGTAGAAGAGTTA GGG (reversed) Intergenic
No off target data available for this crispr