ID: 1010038194 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:71350978-71351000 |
| Sequence | CTTTCCTTGTAGAAGAGTTA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1010038194_1010038196 | -2 | Left | 1010038194 | 6:71350978-71351000 | CCCTAACTCTTCTACAAGGAAAG | No data | ||
| Right | 1010038196 | 6:71350999-71351021 | AGAAGCATAGCCTGTCTGCTTGG | No data | ||||
| 1010038194_1010038198 | 9 | Left | 1010038194 | 6:71350978-71351000 | CCCTAACTCTTCTACAAGGAAAG | No data | ||
| Right | 1010038198 | 6:71351010-71351032 | CTGTCTGCTTGGTGACTGCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1010038194 | Original CRISPR | CTTTCCTTGTAGAAGAGTTA GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||