ID: 1010039428

View in Genome Browser
Species Human (GRCh38)
Location 6:71363643-71363665
Sequence TACACATTTAATAAAATTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010039427_1010039428 -8 Left 1010039427 6:71363628-71363650 CCTGCGATTTGCTGATACACATT No data
Right 1010039428 6:71363643-71363665 TACACATTTAATAAAATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010039428 Original CRISPR TACACATTTAATAAAATTTC AGG Intergenic
No off target data available for this crispr