ID: 1010039820

View in Genome Browser
Species Human (GRCh38)
Location 6:71368222-71368244
Sequence TCTCATGTGCCAGAGGAGAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010039818_1010039820 -8 Left 1010039818 6:71368207-71368229 CCTGTATCACAATCTTCTCATGT No data
Right 1010039820 6:71368222-71368244 TCTCATGTGCCAGAGGAGAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010039820 Original CRISPR TCTCATGTGCCAGAGGAGAA CGG Intergenic
No off target data available for this crispr