ID: 1010040059

View in Genome Browser
Species Human (GRCh38)
Location 6:71370674-71370696
Sequence TTTCTATAGTCAGGTAACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010040059_1010040061 5 Left 1010040059 6:71370674-71370696 CCTGGGTTACCTGACTATAGAAA No data
Right 1010040061 6:71370702-71370724 AAAGAATCAGAGTCAGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010040059 Original CRISPR TTTCTATAGTCAGGTAACCC AGG (reversed) Intergenic
No off target data available for this crispr