ID: 1010041185

View in Genome Browser
Species Human (GRCh38)
Location 6:71386442-71386464
Sequence TTGTGCAAATGTAATCATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010041185_1010041189 -6 Left 1010041185 6:71386442-71386464 CCCACATGATTACATTTGCACAA No data
Right 1010041189 6:71386459-71386481 GCACAAAAATGGACAGGTACTGG No data
1010041185_1010041193 24 Left 1010041185 6:71386442-71386464 CCCACATGATTACATTTGCACAA No data
Right 1010041193 6:71386489-71386511 CAGGTAAAAACCAAAATACTTGG No data
1010041185_1010041190 -5 Left 1010041185 6:71386442-71386464 CCCACATGATTACATTTGCACAA No data
Right 1010041190 6:71386460-71386482 CACAAAAATGGACAGGTACTGGG No data
1010041185_1010041191 -2 Left 1010041185 6:71386442-71386464 CCCACATGATTACATTTGCACAA No data
Right 1010041191 6:71386463-71386485 AAAAATGGACAGGTACTGGGAGG No data
1010041185_1010041192 5 Left 1010041185 6:71386442-71386464 CCCACATGATTACATTTGCACAA No data
Right 1010041192 6:71386470-71386492 GACAGGTACTGGGAGGTAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010041185 Original CRISPR TTGTGCAAATGTAATCATGT GGG (reversed) Intergenic
No off target data available for this crispr