ID: 1010042168

View in Genome Browser
Species Human (GRCh38)
Location 6:71397748-71397770
Sequence ATTTTGGGGAAAAAACATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010042168_1010042175 16 Left 1010042168 6:71397748-71397770 CCTGAATGTTTTTTCCCCAAAAT No data
Right 1010042175 6:71397787-71397809 CTCCTCATGACTTCTGTCTCAGG No data
1010042168_1010042177 26 Left 1010042168 6:71397748-71397770 CCTGAATGTTTTTTCCCCAAAAT No data
Right 1010042177 6:71397797-71397819 CTTCTGTCTCAGGACAAAGAAGG No data
1010042168_1010042170 -10 Left 1010042168 6:71397748-71397770 CCTGAATGTTTTTTCCCCAAAAT No data
Right 1010042170 6:71397761-71397783 TCCCCAAAATTGCACATGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010042168 Original CRISPR ATTTTGGGGAAAAAACATTC AGG (reversed) Intergenic
No off target data available for this crispr