ID: 1010042171

View in Genome Browser
Species Human (GRCh38)
Location 6:71397762-71397784
Sequence GCCAACCATGTGCAATTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010042171_1010042178 22 Left 1010042171 6:71397762-71397784 CCCCAAAATTGCACATGGTTGGC No data
Right 1010042178 6:71397807-71397829 AGGACAAAGAAGGAGCCCATAGG No data
1010042171_1010042177 12 Left 1010042171 6:71397762-71397784 CCCCAAAATTGCACATGGTTGGC No data
Right 1010042177 6:71397797-71397819 CTTCTGTCTCAGGACAAAGAAGG No data
1010042171_1010042175 2 Left 1010042171 6:71397762-71397784 CCCCAAAATTGCACATGGTTGGC No data
Right 1010042175 6:71397787-71397809 CTCCTCATGACTTCTGTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010042171 Original CRISPR GCCAACCATGTGCAATTTTG GGG (reversed) Intergenic
No off target data available for this crispr