ID: 1010042173

View in Genome Browser
Species Human (GRCh38)
Location 6:71397764-71397786
Sequence GAGCCAACCATGTGCAATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010042173_1010042178 20 Left 1010042173 6:71397764-71397786 CCAAAATTGCACATGGTTGGCTC No data
Right 1010042178 6:71397807-71397829 AGGACAAAGAAGGAGCCCATAGG No data
1010042173_1010042175 0 Left 1010042173 6:71397764-71397786 CCAAAATTGCACATGGTTGGCTC No data
Right 1010042175 6:71397787-71397809 CTCCTCATGACTTCTGTCTCAGG No data
1010042173_1010042177 10 Left 1010042173 6:71397764-71397786 CCAAAATTGCACATGGTTGGCTC No data
Right 1010042177 6:71397797-71397819 CTTCTGTCTCAGGACAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010042173 Original CRISPR GAGCCAACCATGTGCAATTT TGG (reversed) Intergenic