ID: 1010042174

View in Genome Browser
Species Human (GRCh38)
Location 6:71397786-71397808
Sequence CTGAGACAGAAGTCATGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010042174_1010042179 10 Left 1010042174 6:71397786-71397808 CCTCCTCATGACTTCTGTCTCAG No data
Right 1010042179 6:71397819-71397841 GAGCCCATAGGATGAAGACAAGG No data
1010042174_1010042180 11 Left 1010042174 6:71397786-71397808 CCTCCTCATGACTTCTGTCTCAG No data
Right 1010042180 6:71397820-71397842 AGCCCATAGGATGAAGACAAGGG No data
1010042174_1010042183 18 Left 1010042174 6:71397786-71397808 CCTCCTCATGACTTCTGTCTCAG No data
Right 1010042183 6:71397827-71397849 AGGATGAAGACAAGGGAATGAGG No data
1010042174_1010042184 19 Left 1010042174 6:71397786-71397808 CCTCCTCATGACTTCTGTCTCAG No data
Right 1010042184 6:71397828-71397850 GGATGAAGACAAGGGAATGAGGG No data
1010042174_1010042178 -2 Left 1010042174 6:71397786-71397808 CCTCCTCATGACTTCTGTCTCAG No data
Right 1010042178 6:71397807-71397829 AGGACAAAGAAGGAGCCCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010042174 Original CRISPR CTGAGACAGAAGTCATGAGG AGG (reversed) Intergenic
No off target data available for this crispr