ID: 1010042175

View in Genome Browser
Species Human (GRCh38)
Location 6:71397787-71397809
Sequence CTCCTCATGACTTCTGTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010042171_1010042175 2 Left 1010042171 6:71397762-71397784 CCCCAAAATTGCACATGGTTGGC No data
Right 1010042175 6:71397787-71397809 CTCCTCATGACTTCTGTCTCAGG No data
1010042172_1010042175 1 Left 1010042172 6:71397763-71397785 CCCAAAATTGCACATGGTTGGCT No data
Right 1010042175 6:71397787-71397809 CTCCTCATGACTTCTGTCTCAGG No data
1010042168_1010042175 16 Left 1010042168 6:71397748-71397770 CCTGAATGTTTTTTCCCCAAAAT No data
Right 1010042175 6:71397787-71397809 CTCCTCATGACTTCTGTCTCAGG No data
1010042173_1010042175 0 Left 1010042173 6:71397764-71397786 CCAAAATTGCACATGGTTGGCTC No data
Right 1010042175 6:71397787-71397809 CTCCTCATGACTTCTGTCTCAGG No data
1010042167_1010042175 22 Left 1010042167 6:71397742-71397764 CCTCTGCCTGAATGTTTTTTCCC No data
Right 1010042175 6:71397787-71397809 CTCCTCATGACTTCTGTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010042175 Original CRISPR CTCCTCATGACTTCTGTCTC AGG Intergenic
No off target data available for this crispr