ID: 1010042176

View in Genome Browser
Species Human (GRCh38)
Location 6:71397789-71397811
Sequence GTCCTGAGACAGAAGTCATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010042176_1010042180 8 Left 1010042176 6:71397789-71397811 CCTCATGACTTCTGTCTCAGGAC No data
Right 1010042180 6:71397820-71397842 AGCCCATAGGATGAAGACAAGGG No data
1010042176_1010042183 15 Left 1010042176 6:71397789-71397811 CCTCATGACTTCTGTCTCAGGAC No data
Right 1010042183 6:71397827-71397849 AGGATGAAGACAAGGGAATGAGG No data
1010042176_1010042184 16 Left 1010042176 6:71397789-71397811 CCTCATGACTTCTGTCTCAGGAC No data
Right 1010042184 6:71397828-71397850 GGATGAAGACAAGGGAATGAGGG No data
1010042176_1010042178 -5 Left 1010042176 6:71397789-71397811 CCTCATGACTTCTGTCTCAGGAC No data
Right 1010042178 6:71397807-71397829 AGGACAAAGAAGGAGCCCATAGG No data
1010042176_1010042179 7 Left 1010042176 6:71397789-71397811 CCTCATGACTTCTGTCTCAGGAC No data
Right 1010042179 6:71397819-71397841 GAGCCCATAGGATGAAGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010042176 Original CRISPR GTCCTGAGACAGAAGTCATG AGG (reversed) Intergenic
No off target data available for this crispr