ID: 1010042178

View in Genome Browser
Species Human (GRCh38)
Location 6:71397807-71397829
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010042174_1010042178 -2 Left 1010042174 6:71397786-71397808 CCTCCTCATGACTTCTGTCTCAG No data
Right 1010042178 6:71397807-71397829 AGGACAAAGAAGGAGCCCATAGG No data
1010042171_1010042178 22 Left 1010042171 6:71397762-71397784 CCCCAAAATTGCACATGGTTGGC No data
Right 1010042178 6:71397807-71397829 AGGACAAAGAAGGAGCCCATAGG No data
1010042176_1010042178 -5 Left 1010042176 6:71397789-71397811 CCTCATGACTTCTGTCTCAGGAC No data
Right 1010042178 6:71397807-71397829 AGGACAAAGAAGGAGCCCATAGG No data
1010042173_1010042178 20 Left 1010042173 6:71397764-71397786 CCAAAATTGCACATGGTTGGCTC No data
Right 1010042178 6:71397807-71397829 AGGACAAAGAAGGAGCCCATAGG No data
1010042172_1010042178 21 Left 1010042172 6:71397763-71397785 CCCAAAATTGCACATGGTTGGCT No data
Right 1010042178 6:71397807-71397829 AGGACAAAGAAGGAGCCCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010042178 Original CRISPR AGGACAAAGAAGGAGCCCAT AGG Intergenic