ID: 1010042498

View in Genome Browser
Species Human (GRCh38)
Location 6:71402280-71402302
Sequence TCAGTTCCAGACCCAGGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010042493_1010042498 17 Left 1010042493 6:71402240-71402262 CCAGGGGTTTTCAGCTTACCAAT No data
Right 1010042498 6:71402280-71402302 TCAGTTCCAGACCCAGGGCCTGG No data
1010042494_1010042498 -1 Left 1010042494 6:71402258-71402280 CCAATTAAAATAGACCACATTCT No data
Right 1010042498 6:71402280-71402302 TCAGTTCCAGACCCAGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010042498 Original CRISPR TCAGTTCCAGACCCAGGGCC TGG Intergenic
No off target data available for this crispr