ID: 1010046005

View in Genome Browser
Species Human (GRCh38)
Location 6:71444359-71444381
Sequence GTGTTATTTTGTAAGGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010046005_1010046007 -10 Left 1010046005 6:71444359-71444381 CCTACTTCCTTACAAAATAACAC No data
Right 1010046007 6:71444372-71444394 AAAATAACACAACAATCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010046005 Original CRISPR GTGTTATTTTGTAAGGAAGT AGG (reversed) Intergenic
No off target data available for this crispr