ID: 1010047521

View in Genome Browser
Species Human (GRCh38)
Location 6:71463657-71463679
Sequence CAACCTCATGATTGGAATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1010047521_1010047525 21 Left 1010047521 6:71463657-71463679 CCTTGATTCCAATCATGAGGTTG No data
Right 1010047525 6:71463701-71463723 CAGAGACATGATTCTGTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1010047521 Original CRISPR CAACCTCATGATTGGAATCA AGG (reversed) Intergenic
No off target data available for this crispr